Fusion protein lhfvii-ldp and enhanced fusion protein lhfvii-ldp-ae and applications thereof

A fusion protein, lhfvii-ldp-ae technology, applied in the fusion protein LhFVII-LDP and strengthened fusion protein LhFVII-LDP-AE and its application field, can solve the problem of strengthened fusion protein and achieve good targeting, Low production cost and reduced immunogenicity

Inactive Publication Date: 2011-12-14
SICHUAN UNIV +1
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there have been no relevant reports on the use of human coagulation factor VII or its light chain as the targeting domain of the drug and the enhanced fusion protein composed of human coagulation factor VII or its light chain and lidamycin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein lhfvii-ldp and enhanced fusion protein lhfvii-ldp-ae and applications thereof
  • Fusion protein lhfvii-ldp and enhanced fusion protein lhfvii-ldp-ae and applications thereof
  • Fusion protein lhfvii-ldp and enhanced fusion protein lhfvii-ldp-ae and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Cloning of the fusion gene encoding the fusion protein LhFVII-LDP

[0028] Primer 1: 5'-TAA CCATGG GCCATCATCATCATCATCACGCCAACGCGTTCCTGGAGGAGCTGCG-3'

[0029] Nco I

[0030] Primer 2: 5'- CCACCACTGCCGCCGCCGCCGCTACCACCACCACCACC TCGGCCTTGGGGTTTGCTGGCATT-3'

[0031] Linker: GGGGS×3 connecting peptide

[0032] Primer 3: 5'- GTGGTGGTAGCGGCGGCGGCGGCAGTGGTGGCGGTGGCTCT GCGCCCGCCTTCTCCGTC-3'

[0033] Linker: GGGGS×3 connecting peptide

[0034] Primer 4: 5'-TAT CTCGAG TTAGCCGAAGGTCAGAGCCACGT-3'

[0035] Xho I

[0036] The above primers were synthesized by Handsome Biotechnology Co., Ltd.

[0037] Using human coagulation factor VII cDNA (Guangzhou Funeng Gene Co., Ltd.) as a template, PCR amplification was performed with primers 1 and 2 to obtain a 521bp DNA fragment containing the coding sequence of human coagulation factor VII light chain and GGGGS×3 connecting peptide ( See figure 1...

Embodiment 2

[0062] Embodiment 2: Construction of the recombinant plasmid expressing fusion protein LhFVII-LDP

[0063] The lhfVIIldp fusion gene fragment cloned in Example 1 was subjected to NcoI / XhoI double digestion, and the restriction gene fragment was connected to the pET-19b vector (Novagen company product) through the same digestion (see figure 2 ), and then transform the ligated product into E.coli DH5α After culturing at 37°C, single clones were picked, plasmids were extracted after a small amount of culture, and identified by NcoI / XhoI double enzyme digestion (for the identification results, see image 3 ). The identified plasmid was sent to Beijing Huada Gene Research Center to sequence the inserted fusion gene fragment, and its nucleotide sequence is shown in SEQ ID NO.3 in the sequence list. The recombinant plasmid containing lhfVIIldp fusion gene with correct sequencing results was named pET19blhfVIIldp.

Embodiment 3

[0064]Example 3: Expression of recombinant plasmids in Escherichia coli

[0065] The recombinant plasmid pET19blhfVIIldp constructed in Example 2 was transformed into Escherichia coli Rosetta-gami B(DE3)pLysS (product of Novagen), and a single clone was picked in LB medium, and cultured with shaking at 37°C until OD 600 ≈0.6, take 15ul bacterial liquid and freeze it at -20°C, then add IPTG (isopropyl-β-D-thiogalactoside) with a final concentration of 0.8mM to continue culturing for 6h, take 7.5ul bacterial liquid and freeze it at -20°C . Take another 5ml of the induced bacterial solution, centrifuge at 4000rpm×3min, discard the supernatant, and use 600ulPBS (preparation method: weigh 8g of NaCl, 0.2g of KCl, NaCl 2 HPO 4 1.44g, KH 2 PO 4 0.24g, dissolved in 900ml of double-distilled water, adjusted the pH value to 7.4 with hydrochloric acid, added water to make up to 1L) and resuspended, the resuspended bacterial solution was ultrasonically crushed, centrifuged at 16000g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A fusion gene encoding the fusion protein LhFVII-LDP is formed by linking the gene encoding the light chain of human blood coagulation factor VII and the gene encoding lidamycin prosthetic protein, and its nucleotide sequence is shown in SEQ ID NO. 3. A recombinant plasmid expressing the fusion protein LhFVII-LDP contains a fusion gene encoding the fusion protein LhFVII-LDP. The fusion protein LhFVII-LDP is expressed from the above-mentioned recombinant plasmid, and its amino acid sequence is shown in SEQ ID NO.4 in the sequence listing. The enhanced fusion protein LhFVII-LDP-AE is composed of the fusion protein LhFVII-LDP whose amino acid sequence is shown in SEQ ID NO.4 in the sequence listing and the enediyne chromophore AE. The fusion protein LhFVII-LDP and the strengthened fusion protein LhFVII-LDP-AE can be used in the preparation of medicines for treating tumors.

Description

technical field [0001] The invention relates to a fusion protein targeting tissue factor, a strengthening fusion protein and its application and preparation method in the preparation of medicines for treating tumors (cancer). Background technique [0002] Tissue factor (TF) is a tumor cell surface receptor that is not expressed in normal tissue vascular endothelial cells, but is specifically highly expressed on the surface of solid tumor neovascular endothelial cells and malignant tumor cells, and is an important target for tumor therapy. point. Lidamycin (LDM), also known as C1027, is produced by an actinomycete (Streptiomyces globisporus C-1027, strain preservation number: CGMCC No.0704) isolated from the soil of Qianjiang City, Hubei Province, my country The enediyne antibiotics are the macromolecular peptide antitumor antibiotics with the strongest killing effect on tumor cells so far. The molecule of lidamycin is composed of two parts: one part is enediyne chromophore ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C12N15/63C07K19/00A61K47/48A61K38/16A61P35/00
Inventor宋旭张青刘秀均胡莲郑艳波廖东升
OwnerSICHUAN UNIV