A markerless gene deletion attenuated mutant strain of Vibrio alginolyticus wild strain, related preparations and applications

A marker-free, alginolytic vibrio technology, applied in microorganism-based methods, medical preparations containing active ingredients, bacteria, etc., can solve the problem that the immune effect is not as good as that of live vaccines, the immune dose and cost are high, and it is not infectious. and other problems, to achieve the effect of eliminating the possibility of toxic pathogens, significant immune effect, and good control effect.

Active Publication Date: 2011-12-28
EAST CHINA UNIV OF SCI & TECH
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the subunit vaccine is not infectious, it can only be immunized by injection rather than soaking, which is inconvenient to operate
And because it only has one or several antigens of the pathogen, and does not contain other antigens and genetic information of the pathogen, only a single antigen molecule is used to induce an immune response, and the immune effect is not as good as that of live vaccines
In addition, subunit vaccines need to be supplemented with adjuvants, the immunization dose and cost are relatively high, and the effect is poor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A markerless gene deletion attenuated mutant strain of Vibrio alginolyticus wild strain, related preparations and applications
  • A markerless gene deletion attenuated mutant strain of Vibrio alginolyticus wild strain, related preparations and applications
  • A markerless gene deletion attenuated mutant strain of Vibrio alginolyticus wild strain, related preparations and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of Markerless Gene Deletion Attenuated Mutants

[0031] (1) Construction of hfq gene deletion strain

[0032] 1) PCR amplification to obtain the desired gene fragment

[0033] Such as figure 1 As shown, the genome of Vibrio alginolyticus strain EPGS020401 (preservation number: CCTCC NO: AB 209306) is used as a template, and the following amplification primers are used:

[0034] P1(TTAGTCGACCCGACAGATGTGGGAGTATTTAGAT),

[0035] P2(TGTGGACGCTCGTCTTGTAGAGATTGCCCCTTAGCC),

[0036] P3(CTCTACAAGACGAGCGTCCACAAAGAGAAATCTGAAG),

[0037] P4(GCTACTAGTGATATCGAGAATAAGACCAGTGCGG),

[0038] First, use P1 and P2, P3 and P4 to amplify the upper and lower fragments F1 and F2 required by Overlap PCR respectively. After each fragment was recovered, the hfq deletion fragment F1F2 was obtained by using P1 and P4 using the Overlap PCR technique.

[0039] 2) Recover each fragment

[0040] To recover the target gene fragment from the object to be studied, use the g...

Embodiment 2

[0056] Embodiment 2: Taking zebrafish (Danio rerio) as the semi-lethal dose LD of experimental animals 50 Determination:

[0057] The fish used in the experiment were first placed in the SPF (Specific Pathogen Free) laboratory to adapt to breeding for 1 week to remove abnormal individuals. Before the infection test, the SPF test fish were stocked in a 0.5L infection test tank in the Challenge Lab, and continued to be fed for 1 week, with 10 fish (average body length 2.5-3cm, body weight 0.2g) in each tank. The test tank replaced 1 / 2 volume of culture water with sterile old water every day, and the water temperature was 28°C, with a fluctuation of 2°C.

[0058] The fish used in the test were randomly divided into groups, and two tanks were tested in parallel in each group. In the infection test, each group of test fish was treated with a certain gradient dose (10 2 -10 7 CFU / tail) of Vibrio alginolyticus wild strain and attenuated vaccine strain were artificially infected b...

Embodiment 3

[0063] Embodiment 3: Taking zebrafish as the experimental animal's immune protection test by injection

[0064] The experimental zebrafish were randomly divided into 3 groups, each with 3 parallel tanks, 10 fish per tank. The prepared attenuated live vaccine was immunized by intramuscular injection. Injection immunization dose is 7×10 5 CFU / g, intramuscular injection test zebrafish. The control group was injected with sterile normal saline. After 4 weeks of immunization, the zebrafish of each group were infected with live bacteria of the wild strain of Vibrio alginolyticus (intramuscular injection of 5×10 5 CFU / tail) for artificial infection challenge. Observe and count the control group and the number of immune deaths within 15 days to calculate the immune protection rate of each group (see Table 2).

[0065] Wherein, the immune protection rate was calculated according to the following formula: immune protection rate%=(control group death rate−immune group death rate%) / c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an unmarked gene-deleted and attenuated mutant strain of a vibrio alginolyticus wild strain, which is the attenuated active vaccine of the vibrio alginolyticus wild strain and in which the sRNA molecular chaperone gene hfq of the vibrio alginolyticus wild strain is deleted. The vibrio alginolyticus wild strain is EPGS020401, and the collection number of the vibrio alginolyticus wild strain is CCTCC NO.AB 209306. The invention also provides the preparation of the unmarked gene-deleted and attenuated mutant strain of the vibrio alginolyticus wild strain and the use thereof in prevention and control of vibrio alginolyticus disease in cultured fish. The unmarked gene-deleted and attenuated mutant strain of the vibrio alginolyticus wild strain or the preparation thereof, which are disclosed by the invention, eliminates universal potential environment and product safety risks of the conventional attenuated vaccine and is a safe, effective and economic vaccine for preventing and controlling vibrio alginolyticus diseases in cultured fish.

Description

technical field [0001] The present invention relates to the technical field of attenuated mutant strains, in particular to the technical field of bacterial live attenuated vaccines for fish, and specifically refers to an unmarked gene-deleted attenuated mutant strain of a wild strain of Vibrio alginolyticus, related preparations and applications. Background technique [0002] With the growing population of the world, the increasing demand for seafood and the increasingly depleted natural fishery resources, the contradiction between aquaculture, as a traditional industry, has developed rapidly and effectively in modern times. Its important position has been highlighted in society, economy and people's life. According to statistics, in 2002, the total amount of aquatic products in my country accounted for 71% of the global total output and 49.8% of the total output value, ranking first in the world. According to statistics from the Ministry of Agriculture, the total output of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/20A61K39/106A61P31/04C12R1/63
Inventor王启要刘欢张元兴刘琴
OwnerEAST CHINA UNIV OF SCI & TECH