Expression cassette mazF-cassette for expressing escherichia coli toxin protein mazF gene and construction method and application thereof

A technology for expressing Escherichia coli and toxin proteins, applied in the field of genetic engineering, can solve the problems of long cycle, affecting the expression of adjacent genes, and adverse effects on the physiological state of strains

Active Publication Date: 2014-06-18
ZHEJIANG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the presence of marker genes in modified bacterial strains has brought a lot of inconvenience to the follow-up research of bacterial strains, and has the following disadvantages: one, the marker genes that can be used as Bacillus subtilis screening genes for genetic manipulation are very limited at present, when a certain bacterial strain has been When there is a selectable marker gene, the marker gene can no longer be used as a selectable marker in the subsequent genetic manipulation, and the antibiotic gene must be deleted or replaced by other resistance genes; two, introducing too many antibiotic resistance genes in a bacterial strain often It will have adverse effects on some physiological states of the strain, such as affecting the expression of adjacent genes, etc.
However, this system also has some shortcomings, such as it requires restriction endonuclease digestion and ligation process, and the cycle is long, and it takes about 2 weeks to construct a recombinant; Leaky expression leads to natural mutations to produce mazF-resistant strains; recently, different scholars have improved the system (Morimoto et al. The cycle and leakage of toxin proteins have been improved, but there are still big problems. The deletion or insertion inactivation of genes requires at least 3600bp recombinant PCR fragments, and still requires restriction endonuclease treatment and ligation processes. Long-segment PCR products It is bound to affect the amplification efficiency and accuracy of PCR

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression cassette mazF-cassette for expressing escherichia coli toxin protein mazF gene and construction method and application thereof
  • Expression cassette mazF-cassette for expressing escherichia coli toxin protein mazF gene and construction method and application thereof
  • Expression cassette mazF-cassette for expressing escherichia coli toxin protein mazF gene and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] The construction of the expression cassette of embodiment 1 Escherichia coli toxin protein mazF gene

[0071] (1) Primers:

[0072] 5ZeoRF: ggcGTCGACGGATCCGAATTCAAGCTTCAGTCCTGCTCCTCGGCCAC

[0073] 3ZeoRR: TTCATGAAAGACTTGATATGGCTTTTTATATGTG

[0074] 5PxylF: CATATCAAGTCTTTCATGAAAAACTAAAAAAATATT

[0075]3PxylR:ACCAGATCCTCCTTTAGATGCATTTTATGTCATATTGTA

[0076] 5SOEmazF;CATCTAAAGGAGGATCTGGTAATGGTAAGCCGATA

[0077] 3SOEmazR: ggcTCTAGACTACCCCAATCAGTACGTTAAT

[0078] (2) Gene amplification

[0079] The zeocin resistance gene was amplified by PCR using the plasmid pDGCZ as a template and 5ZeoRF / 3ZeoRR as primers; the xylose promoter gene was amplified by PCR using the plasmid pSG1729 as a template and 5PxylF / 3PxylR as primers; PCR amplification of the mazF gene for primers;

[0080] The reaction systems are respectively: 5×PrimeSTAR Buffer (Mg 2+ ) 10 μl, dNTP Mixture (2.5 mM each) 4 μl, upstream primer 1 μl, downstream primer 1 μl, template DNA 2 μl, PrimeSTAR HS DNA Pol...

Embodiment 2

[0094] Example 2 Verification of the expression cassette function of the Escherichia coli toxin protein mazF gene

[0095] (1) Verification of amylase activity

[0096] The strains verified as positive transformants by PCR, named ZPM6 (Zeocin-PxylA-MazF) and the control strain 1A751 were respectively planted on solid plates of LB+1% starch, and counterstained with iodine solution the next day to detect their Amylase activity ( figure 2 C and D); the results showed that the ZPM6 strain could not form a transparent image on starch culture, and lost amylase decomposing bacteria, indicating that mazF-cassette was inserted into the amylase gene (amyE) position; while the control strain 1A751 was due to the presence of complete starch The enzyme gene (amyE) can form a transparent image on starch medium.

[0097] (2) Verification of reverse screening function

[0098] The above-mentioned ZPM6 (Zeocin-PxylA-MazF) and the control strain 1A751 were respectively streaked on solid pla...

Embodiment 3

[0099] Embodiment 3 Bacillus subtilis amylase gene (amyE) does not have the deletion of resistance marker

[0100] (1) Primer

[0101] 5maZF (Box): AATCAATAATGGACCAGACGACAGTCCTGCTCCTCGGCCAC

[0102] 3SO EmazR: GGCTCTAGACTACCCCAATCAGTACGTTAAT

[0103] 5fPamyE: AGTCTTCAAAAAATCAAATAAGGAGT

[0104] 3fPamyE: TCGTCTGGTCCATTATTGATTTGATAAACG CTTAACCTCATTGGAAATCGCG

[0105] 5bPamyE: TGATTGGGTAGTCTAGAGCCCAGATGCGAATACAACAAAAGC

[0106] 3bPamyE: GTAAGTCCCGTCTAGCCTTGCCCTC

[0107] Note: The underline is the 30bp of the direct repeat (Direct-repeat) with the homologous fragment at the 3' end.

[0108] (2) Gene amplification

[0109] The mazF-cassette gene was amplified by PCR using the Bacillus subtilis ZPM6 genome as a template and 5maZF(Box) / 3SOEmazR as primers; using the Bacillus subtilis 1A751 genome as a template and 5fPamyE / 3fPamyE as primers to amplify the 5' homologous fragment by PCR; The genome of Bacillus subtilis 1A751 was used as a template, and 5bPamyE / 3bPamyE was use...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an expression cassette mazF-cassette for expressing escherichia coli toxin protein mazF gene, the nucleotide sequence of which is SEQ ID NO:1. The invention also discloses a construction method of the expression cassette mazF-cassette, comprising the following steps of: 1) amplifying the escherichia coli toxin protein mazF gene; 2) amplifying xylose-induced promoter Pxyl A gene; 3) amplifying a resistant gene zeocin; 4) fusing the above three PCR segments into a recombinant PCR segment; 5) carrying out enzyme digestion on the recombinant PCR segment by the use of restriction enzyme Sal I / Xba I, connecting with an integrative vector Psg1729 which undergoes the same enzyme digestion, transforming bacillus subtilis 1A751 to obtain a transformant which is a host bacteria containing the expression cassette. The expression cassette mazF-cassette can be used to construct a bacillus subtilis general label-free homologous recombination system.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for site-directed mutation, deletion and introduction of exogenous genes. Background technique [0002] Bacillus subtilis is a type of aerobic rod-shaped bacteria. Under extreme conditions, it can also induce the production of endogenous spores with strong stress resistance. It widely exists in soil, lakes, oceans, etc., and has no pathogenicity itself. It has only a single layer of outer membrane and can directly secrete many proteins into the medium. Bacillus subtilis is the first genetically engineered expression strain in Bacillus, and it is widely used in the production of industrial enzymes. Therefore, B. subtilis has received more and more attention as an expression strain. [0003] The vectors of Bacillus subtilis expression system mainly include self-replicating plasmids, integrating plasmids and phages. According to the different replication metho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/75C12N15/66C12R1/19C12R1/125
Inventor李卫芬林志伟余东游吴兵兵徐歆邓斌
OwnerZHEJIANG UNIV