Unlock instant, AI-driven research and patent intelligence for your innovation.

CpG oligonucleotide possessing immune enhancement activity to aquatic livestock, its preparation method and its application

An oligonucleotide and immune enhancement technology, which is applied in the field of CpG oligonucleotide and its preparation and application, can solve the problems of slow progress in the research of effective drugs or feed additives, and achieve the enhancement of innate immune response, simple technology, time-consuming effect

Active Publication Date: 2012-04-04
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But overall, research progress on effective drugs or feed additives for marine invertebrate disease control is still very slow

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CpG oligonucleotide possessing immune enhancement activity to aquatic livestock, its preparation method and its application
  • CpG oligonucleotide possessing immune enhancement activity to aquatic livestock, its preparation method and its application
  • CpG oligonucleotide possessing immune enhancement activity to aquatic livestock, its preparation method and its application

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0021] The base sequence of the CpG oligonucleotide having immune-enhancing activity for aquaculture animals such as shrimps and crabs is shown in SEQ ID NO.1 in the sequence table.

[0022] SEQ ID NO.1

[0023] ACCGATGTCGTTGCCGGTGAGGGGGACGATCGTCGGGGGGTCGTCGTTTTGTCGTTTTGTCGT

[0024] TTCGTCGTTTTCGGCGCGCGCCGTTTCCATGACGTCCCTGATGCTCTCGAGGA

[0025] (a) Sequence features:

[0026] ●Length: 116bp

[0027] ●Type: DNA

[0028] ●Chain type: double chain

[0029] (b) Molecular type: double-stranded DNA

[0030] (c) Assumption: No

[0031] (d) Antisense: no

[0032] (e) Original source: Synthetic

[0033] (f) Specific name: gene

Embodiment 2

[0035] 1. Plasmid construction and transformation of CpG-rich oligonucleotide sequences (CpG ODNs)

[0036] Design five motifs with CpG characteristics and synthesize them end to end (Shanghai Sangong) to obtain a sequence rich in CpG oligonucleotides (CpG-ODN). Combine the synthesized CpG-ODN with the pUC57 plasmid (Shanghai Sangong) connected. Subsequently, the recombinant plasmid was introduced into Escherichia coli DH5α strain, and the specific steps were as follows. After the recombinant plasmid and Escherichia coli DH5α competent cells were pre-cooled for 30 minutes, 5 μL of the plasmid was added to the competent cells, heat-shocked at 42°C for 90 seconds, and quickly placed on ice for 2 minutes. Then add 200 μL LB liquid medium, culture at 37° C., 200 rpm for 45 minutes. Take 80 μL and spread it on a plate containing 50 μg / ml ampicillin, and incubate at 37°C for about 12 hours. Randomly pick several monoclonal colonies and culture them in LB liquid medium containing ...

Embodiment 3

[0045] The extract (CpG ODNs) of the oligonucleotide CpG ODNs with the nucleotide sequence shown in the sequence table SEQ ID NO.1 obtained in the above-mentioned Example 2 is added to the Litopenaeus vannamei feed (see Table 1 for feed ingredients) ), will pass through 28d cultivation, when adding the oligonucleotide CpG ODNs of the base sequence shown in 40mg above-mentioned sequence table SEQ ID NO.1 in every kilogram of feed, obviously promote the growth of prawn, concrete situation brief table 2 The relative growth rate and the weight gain rate of the added group are all higher than the base feed group, the growth rate is 9.7% higher than the base feed group, and the weight gain rate is 19.4% higher than the base feed group.

[0046] Table 1 Basic feed composition of Litopenaeus vannamei

[0047]

[0048] Table 2 Effects of adding CpG-ODN on the growth of Litopenaeus vannamei in feed

[0049]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to molecular biology, concretely relates to CpG oligonucleotide possessing immune enhancement activity to aquatic livestock such as shrimps and crabs, its preparation method and its application. The CpG oligonucleotide possessing immune enhancement activity has a basic group sequence shown in a sequence table SEQ ID NO.1. The preparation method comprises the following steps: conversing plasmid containing the CpG oligonucleotide sequence into a colibacillus DH5alpha strain, fermenting, collecting the fermented product, separating and purifying CpG ODNs by an isopropanol sedimentation method. The basic group sequence CpG oligonucleotide shown in the sequence table SEQ ID NO.1 can be used as an aquaculture feed additive or an immunopotentiator, such as 10-100mg of the CpG oligonucleotide added in one kilogram feed is capable of obviously promoting the growth of the breeding animals. According to the invention, a biological engineering fermentation technology and a simplified extraction method are used for amplifying and extracting CpG oligonucleotide with large amount, so that the time and the labor can be saved by comparing with that under the experiment condition, and the efficiency is higher. The method for preparing the CpG oligonucleotide is convenient for industrial extension.

Description

technical field [0001] The invention relates to molecular biology, in particular to a CpG oligonucleotide with immunoenhancing activity for aquatic animals and its preparation and application. Background technique [0002] With the sharp decline of fishing resources, mariculture has become the main measure generally adopted by the international community to meet the increasing protein demand of human beings. According to the World Food and Agriculture Organization (FAO), the growth of aquatic products since 2000 has mainly come from mariculture. In recent years, my country's marine aquaculture industry has made great progress and leapt into the world's advanced ranks. According to the 2007 my country Fishery Statistical Yearbook, the total output of aquatic products in my country was 47.4752 million tons in 2007, and the aquaculture output was 32.7833 million tons, accounting for 69% of the total output. Mariculture has become an important part of my country's national eco...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/117C12N15/10A23K1/16
Inventor 邱丽梅孙瑞岳峰张莹王玲玲张峘宋林生
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More