CpG oligonucleotide possessing immune enhancement activity to aquatic livestock, its preparation method and its application
An oligonucleotide and immune enhancement technology, which is applied in the field of CpG oligonucleotide and its preparation and application, can solve the problems of slow progress in the research of effective drugs or feed additives, and achieve the enhancement of innate immune response, simple technology, time-consuming effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
experiment example 1
[0021] The base sequence of the CpG oligonucleotide having immune-enhancing activity for aquaculture animals such as shrimps and crabs is shown in SEQ ID NO.1 in the sequence table.
[0022] SEQ ID NO.1
[0023] ACCGATGTCGTTGCCGGTGAGGGGGACGATCGTCGGGGGGTCGTCGTTTTGTCGTTTTGTCGT
[0024] TTCGTCGTTTTCGGCGCGCGCCGTTTCCATGACGTCCCTGATGCTCTCGAGGA
[0025] (a) Sequence features:
[0026] ●Length: 116bp
[0027] ●Type: DNA
[0028] ●Chain type: double chain
[0029] (b) Molecular type: double-stranded DNA
[0030] (c) Assumption: No
[0031] (d) Antisense: no
[0032] (e) Original source: Synthetic
[0033] (f) Specific name: gene
Embodiment 2
[0035] 1. Plasmid construction and transformation of CpG-rich oligonucleotide sequences (CpG ODNs)
[0036] Design five motifs with CpG characteristics and synthesize them end to end (Shanghai Sangong) to obtain a sequence rich in CpG oligonucleotides (CpG-ODN). Combine the synthesized CpG-ODN with the pUC57 plasmid (Shanghai Sangong) connected. Subsequently, the recombinant plasmid was introduced into Escherichia coli DH5α strain, and the specific steps were as follows. After the recombinant plasmid and Escherichia coli DH5α competent cells were pre-cooled for 30 minutes, 5 μL of the plasmid was added to the competent cells, heat-shocked at 42°C for 90 seconds, and quickly placed on ice for 2 minutes. Then add 200 μL LB liquid medium, culture at 37° C., 200 rpm for 45 minutes. Take 80 μL and spread it on a plate containing 50 μg / ml ampicillin, and incubate at 37°C for about 12 hours. Randomly pick several monoclonal colonies and culture them in LB liquid medium containing ...
Embodiment 3
[0045] The extract (CpG ODNs) of the oligonucleotide CpG ODNs with the nucleotide sequence shown in the sequence table SEQ ID NO.1 obtained in the above-mentioned Example 2 is added to the Litopenaeus vannamei feed (see Table 1 for feed ingredients) ), will pass through 28d cultivation, when adding the oligonucleotide CpG ODNs of the base sequence shown in 40mg above-mentioned sequence table SEQ ID NO.1 in every kilogram of feed, obviously promote the growth of prawn, concrete situation brief table 2 The relative growth rate and the weight gain rate of the added group are all higher than the base feed group, the growth rate is 9.7% higher than the base feed group, and the weight gain rate is 19.4% higher than the base feed group.
[0046] Table 1 Basic feed composition of Litopenaeus vannamei
[0047]
[0048] Table 2 Effects of adding CpG-ODN on the growth of Litopenaeus vannamei in feed
[0049]
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
