Engineering bacteria for expressing L-lactate dehydrogenase subjected to orthogenetic evolution and application thereof

A lactate dehydrogenase and directed evolution technology, which is applied in the application field of splitting racemic mandelic acid and producing R-mandelic acid and acetophenone acid, achieving obvious effect, short growth cycle and high substrate concentration. Effect

Active Publication Date: 2012-07-11
上海肆芃科技有限公司
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] After searching, there is no report on the method of producing R-mandelic acid and acetophenone acid using the whole cell catalyst of the engineered strain exogenously expressing mutant L-iLDH

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria for expressing L-lactate dehydrogenase subjected to orthogenetic evolution and application thereof
  • Engineering bacteria for expressing L-lactate dehydrogenase subjected to orthogenetic evolution and application thereof
  • Engineering bacteria for expressing L-lactate dehydrogenase subjected to orthogenetic evolution and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Construction of engineering bacteria expressing directed evolution L-lactate dehydrogenase

[0051] (1) Genomic DNA of Pseudomonas stutzeri (Pseudomonas stutzeri SDM, CCTCC No.M206010) was prepared by conventional methods. For this process, please refer to the small part of the bacterial genome in the "Guidelines for Molecular Biology" published by Science Press. method of preparation. The gene encoding L-iLDH was amplified from the genome of Pseudomonas stutzeri SDM using a PCR reaction.

[0052] The PCR reaction procedure is:

[0053] a. Pre-denaturation at 95°C for 10 minutes

[0054] b. Denaturation at 95°C for 30 seconds

[0055] c. Annealing at 60°C for 30 seconds

[0056] d. Extend at 72°C for 1 minute

[0057] Repeat process b-d for 30 cycles

[0058] e. Supplementary extension for 10 minutes

[0059] The primers used are:

[0060] Upstream primer lldU: AAGCTTATGATCATTTCCGCCTCTACC, containing HindIII restriction site

[0061] Downstream prime...

Embodiment 2

[0085] Example 2: Application of Highly Expressed Mutant L-iLDH Engineering Escherichia coli in Resolution of Racemic Mandelic Acid

[0086] (1) Preparation of Escherichia coli complete cells expressing mutant L-iLDH:

[0087] Plate culture: Streak inoculation of Escherichia coli C43 (DE3) strain containing pETDuet-1-mlldD vector on solid LB medium containing ampicillin at a concentration of 1 mg / ml, culture at 37°C for 12 hours, pick Take a single colony;

[0088] Seed culture: Inoculate the picked single colony into 5 ml of liquid LB medium containing ampicillin at a concentration of 1 mg / ml, and incubate at 37°C for 10 hours;

[0089] Preparation of high-expression mutant L-iLDH whole-cell catalyst: transfer the seeds to 1 liter of LB medium (as in a 5-liter Erlenmeyer flask) with a 1% inoculum size, and cultivate at 37°C until OD 620nm When reaching 0.6, add isopropylthiogalactopyranoside (IPTG) at a final concentration of 1 mmol / L to start inducing the expression of the...

Embodiment 3

[0092] Example 3: Application of Highly Expressed Mutant L-iLDH Engineering Escherichia coli in Resolution of Racemic Mandelic Acid

[0093] (1) Preparation of Escherichia coli complete cells expressing mutant L-iLDH:

[0094] Plate culture: Streak inoculation of Escherichia coli C43 (DE3) strain containing pETDuet-1-mlldD vector on solid LB medium containing ampicillin at a concentration of 1 mg / ml, culture at 37°C for 12 hours, pick Take a single colony;

[0095] Seed culture: Inoculate the picked single colony into 5 ml of liquid LB medium containing ampicillin at a concentration of 1 mg / ml, and incubate at 37°C for 8 hours;

[0096] Preparation of high-expression mutant L-iLDH whole-cell catalyst: transfer the seeds to 1 liter of LB medium (as in a 5-liter Erlenmeyer flask) with a 1% inoculum size, and cultivate at 37°C until OD 620nm When 0.5 was reached, isopropylthiogalactopyranoside (IPTG) was added at a final concentration of 1.2 mmol / L to start inducing the express...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses engineering bacteria for expressing L-lactate dehydrogenase subjected to orthogenetic evolution, which is engineering escherichia coli capable of heterologously expressing NAD (Nicotinamide Adenine Dinucleotide) independent L-lactate dehydrogenase subjected to orthogenetic evolution. The engineering bacteria can highly express corresponding mutant protein on the basis of commercial escherichia coli C43 (DE3) and through transporting an expression vector pETDuet-1-mlldD containing the mutant NAD independent L-lactate dehydrogenase, and has the S-mandelic acid degrading activity. The invention also discloses an application of the engineering bacteria in the resolution of racemic mandelic acid. The racemic mandelic acid is conducted through taking intact cells of the constructed engineering bacteria as a catalyst, and meanwhile, homochiral R-mandelic acid and benzoyl formic acid are produced. The engineering bacteria has the advantages of high substrate utilization rate, high product concentration, high optical purity, simplicity and convenience in future extraction, and the like.

Description

technical field [0001] The present invention relates to an Escherichia coli engineering bacterium and its application, in particular to an engineering Escherichia coli capable of exogenously expressing directed evolution of NAD (nicotinamide adenine dinucleotide)-independent L-lactate dehydrogenase, and the Application of engineering bacteria in splitting racemic mandelic acid and co-producing R-mandelic acid and acetophenone acid. Background technique [0002] R-mandelic acid and its derivatives are important fine chemicals and intermediates in the synthesis of various drugs. High-purity chiral R-mandelic acid can be used to synthesize semi-synthetic penicillins, cephalosporins, anticancer antibiotics and anti-obesity drugs "Preparation of(R)-(-)-mandelic acid and its derivatives from racemates by enantioselective degradation with anewly Isolated bacterial strain Alcaligenes sp. ECU0401. Bioprocess. Biosyst. Eng. 2008, 31: 445-451. ". R-mandelic acid can also be used as a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12P41/00C12P7/42C12P7/40C12R1/19
Inventor许平姜天翼高超马翠卿
Owner上海肆芃科技有限公司