Riemerella anatipestifer-escherichia coli outer membrane protein bivalent vaccine and preparation method thereof
An outer membrane protein, Reesei technology, applied in chemical instruments and methods, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problem of difficulty in both antigen content and protection, and achieve extensive cross-protection Function, suitable for large-scale production, good defense effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Construction of the prokaryotic expression strain of R. anatipestifer RA1, RA2 type outer membrane protein
[0042] (1) Design of primers
[0043] Specific primers were designed according to the OMPA gene sequence of R. anatipestifer ATCC11845 strain (Accession No. AF104937) in Genebank. The upstream primer introduced the BamH I restriction site, and the downstream primer introduced the Xho I restriction site.
[0044] Its primer sequence is as follows:
[0045] RA-OMPA-F: GCT GGATCC ATGGGTAAAGAATTTATG
[0046] RA-OMPA-R:AGT CTCGAG TCTTACAAGAAGAGGACGCTT
[0047] (2) Genome extraction
[0048] A, Streak inoculation of R. anatipestifer RA1 type, RA2 type bacterial classification on the tryptone soybean agar (TSA) plate containing 2% newborn bovine serum, cultivate 24h in 37 ℃ of incubators;
[0049] B. Pick a single colony and inoculate it in the Martin Broth liquid medium, and shake it on a shaker at 37°C overnight;
[0050] C. Transfer the bacterial so...
Embodiment 2
[0066] Example 2 Avian pathogenic Escherichia coli O 78 Construction of Outer Membrane Protein Prokaryotic Expression Strain
[0067] (1) Design of primers
[0068] Specific primers were designed according to the OMPA gene sequence of Escherichia coli K12W3110 strain (accession number AP009048) in Genebank, the upstream primer introduced the BamH I restriction site, and the downstream primer introduced the XhoI restriction site.
[0069] Its primer sequence is as follows:
[0070] E-OMPA-F: AT GGATCC GCTCCGAAAGATAAC
[0071] E-OMPA-R: ATA CTCGAG TTAAGCCTGCGGCTGAGT
[0072] (2) Genome extraction
[0073] A. Avian pathogenic Escherichia coli O 78 Streak inoculation of strains on MB agar plate, culture at 37°C for 36h;
[0074] B. Pick a single colony and inoculate it in MB liquid medium, and shake it on a shaker at 37°C overnight;
[0075] C. Transfer the bacterial solution to a 1.5mL eppendorf tube, centrifuge at 8000r / min for 2min, discard the supernatant, add 500μL ...
Embodiment 3
[0091] Example 3 Induced expression and mass production of R. anatipestifer RA1, RA2 outer membrane protein prokaryotic expression strains
[0092] (1) Induced expression of prokaryotic expression positive bacteria of R. anatipestifer RA1 and RA2 outer membrane proteins screened
[0093] Inoculate the preserved bacterial solution into 5mL LB medium with Kan resistance at a ratio of 1:1000 by volume, and inoculate two tubes for each bacterium, one for induction and the other for non-induced control, and at the same time inoculate One tube of empty plasmid bacteria was used as a control. Incubate overnight at 37°C to OD 600nm When the value is about 0.4, add IPTG to the induction tube and the empty plasmid control tube to a final concentration of 1mmol / L, and do not add IPTG to the non-induced control tube. After culturing at 37°C for 4 hours, take out 1mL bacterial solution from each tube and put it in 1.5mL eppendorf every half hour. Label the tube, centrifuge at 12000rpm, d...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com