Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer and probe for fluorescent RT-PCR (reverse transcription-polymerase chain reaction) assay of peste des petits ruminant vaccine strain viruses

A technology of RT-PCR and Peste des petits ruminants, which is applied in the direction of fluorescence/phosphorescence, biochemical equipment and methods, and microbial measurement/inspection, can solve the problems of difficult virus detection of Peste des petits ruminants vaccine strains, and improve inspection efficiency, Reliable results and reduced testing costs

Inactive Publication Date: 2012-07-18
SHENZHEN AUDAQUE DATA TECH
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is to provide primers and probes for fluorescent RT-PCR detection of the virus of the Peste des petits ruminants vaccine strain in view of the difficulty in detecting the virus of the Peste des Petits Ruminants vaccine strain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe for fluorescent RT-PCR (reverse transcription-polymerase chain reaction) assay of peste des petits ruminant vaccine strain viruses
  • Primer and probe for fluorescent RT-PCR (reverse transcription-polymerase chain reaction) assay of peste des petits ruminant vaccine strain viruses
  • Primer and probe for fluorescent RT-PCR (reverse transcription-polymerase chain reaction) assay of peste des petits ruminant vaccine strain viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] (1) Preparation of the template to be tested

[0041] Method 1: Use a commercial RNA extraction kit and follow the instructions.

[0042] Method 2. Extraction method with Trizol nucleic acid extraction reagent:

[0043] a. Take the cell culture solution of Peste des petits ruminants virus, after inactivation, centrifuge at 12000rpm to remove macromolecular impurities. Add 100 μL of supernatant to a 1.5ml centrifuge tube, then add 300 μL of Trizol tissue extract to it, and oscillate fully on a shaker. Then centrifuge at 12000rpm for 15min, and transfer the supernatant to a 1.5ml centrifuge tube;

[0044] b. Add 400 μL of pre-cooled isopropanol to the supernatant, shake fully on the shaker, and centrifuge at 12,000 rpm for 10 minutes to obtain RNA precipitation;

[0045] c. Pour off the supernatant carefully, add 600 μL of 75% ethanol, and wash by hand upside down several times. (Note: Do not shake vigorously to prevent RNA fragmentation and difficulty in re-precipita...

Embodiment 2

[0053] Specificity test of the real-time fluorescent RT-PCR method for the vaccine strain of Peste des petits ruminants:

[0054] In the 25 μ L reaction system, add the nucleic acid of foot-and-mouth disease virus (FMDV), vesicular stomatitis virus (VSV), bluetongue virus (BTV) and Peste des petits ruminants wild strain simultaneously as template, use specific primer of the present invention and Probe carries out real-time fluorescent RT-PCR detection, and the result only has the specific amplification curve of Peste des petits ruminants vaccine strain, and the nucleic acid of FMDV, VSV, BTV and PPRV wild strain has no amplification curve, confirms that the present invention is aimed at PPRV vaccine strain Virus primers and probes have good specificity ( figure 2 ).

Embodiment 3

[0056] Sensitivity test of real-time fluorescent RT-PCR method for PPR vaccine strain virus:

[0057] In the 25 μ L reaction system, after extracting the nucleic acid of the Peste des petits ruminants vaccine strain virus to measure the concentration, make eight 10-fold serial dilutions, and perform real-time fluorescent RT-PCR detection to obtain a dilution gradient series amplification curve ( image 3 ), it was found that the lowest dilution that could be detected was 10 -5 , corresponding to a concentration of 1.38 pg / μL RNA.

[0058] The detection by the present invention is easy and quick to operate, generally can be completed in about 3 hours, and the result can be detected in real time during the detection process, without the need for electrophoresis observation of amplified products, avoiding the contamination between amplified products and electrophoretic observation When EB pollutes the environment.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer sequence and a probe sequence for the real-time fluorescent RT-PCR assay of peste des petits ruminant vaccine strain viruses, the primer sequence includes a primer pair consisting of an upstream primer PPrV-YM1 and a downstream primer PPrV-YM2, the sequences of the upstream primer PPrV-YM1 and the downstream primer PPrV-YM2 are AGGCAGCAAGCCGCAGA and TCCGGTGGTG TCGGATGTGT, or the primer sequence includes a primer pair consisting of the complementary sequence TCCGTCGTTCGGCGTCT of the upstream primer and the complementary sequence AGGCCACCACAGCCTACACA of the downstream primer. The sequence of the probe PPrV-YMp is CCTGTTTACCGCTGGCGTCTCCG, or the complementary sequence of the probe PPrV-YMp is GGACAAATGGCGACCGCAGAGGC. The invention has the advantages of reliable, accurate and sensitive result, time and labor saving, assay cost reduction, assay efficiency increase and the like, is easy to operate, and is particularly suitable for the rapid assay of a large quantity of samples and the rapid diagnosis of emergency epidemics.

Description

technical field [0001] The invention relates to a primer and a probe for fluorescent RT-PCR detection, more specifically, a primer and a probe for fluorescent RT-PCR detection of a vaccine strain of Peste des petits ruminants. Background technique [0002] Peste des petits ruminants (PPR), also known as pseudorinderpest in small ruminants, is an acute and severe infectious disease caused by Peste des petits ruminants virus of the Paramyxoviridae family and the genus Morbillivirus. Peste des petits ruminants is clinically characterized by sudden fever, stomatitis, diarrhea and pneumonia. It mainly infects goats, sheep and some wild small ruminants, and seriously harms sheep, especially goats. [0003] Peste des petits ruminants was first discovered in Côte d'Ivoire in West Africa in 1942, and the disease was subsequently confirmed to exist in Nigeria, Senegal and Ghana in Africa. In recent years, the disease has shown a tendency to spread, and it has become more and more obv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11G01N21/64
Inventor 吕建强张彩虹杨俊兴花群义曹琛福阮周曦孙洁陶虹曾少灵廖立珊
Owner SHENZHEN AUDAQUE DATA TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com