Application of protein ATCTPA2 related to photosynthesis
A protein and protein technology, applied in the biological field, can solve the problems such as no reports of Arabidopsis CtpA enzyme
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Embodiment 1, discovery process of gene function
[0042] 1. Identification of mutant materials
[0043] A mutant homozygous (salk_056011) for the T-DNA insertion of the nuclear-encoded gene At4g17740 located in the chloroplast was purchased from ABRC (Arabidopsis Biological Resource Center) in the United States. According to the protein structure domain and sequence comparison, the gene may be the The gene encoding CtpA is named AtctpA2, and the encoded protein is named ATCTPA2.
[0044] Mutant homozygous for T-DNA insertion and wild-type Arabidopsis (ordered in ABRC library, Col-0 type) were grown on MS medium with a growth light intensity of 40±5 μmol m -2 ·s -1 , the result is as figure 1 As shown, the left is wild-type Arabidopsis (WT), the right is the T-DNA insertion mutant homozygote (AtctpA2), and it is found that the cotyledons of the T-DNA insertion mutant homozygote are yellowed compared with wild-type Arabidopsis , light green true leaves, short plants...
Embodiment 2
[0061] Embodiment 2, transgene complementation experiment
[0062] 1. Acquisition of atctpa2 gene
[0063] The nucleotide sequence of the atctpa2 gene is sequence 1 in the sequence table, primers were designed according to the sequence between 1-1545bp, and amplified from the genome of Arabidopsis thaliana (Col-0 ecotype, purchased from the Arabidopsis Biological Resource Center) Gene. The primers used are as follows: Former: 5'CATG CCATGG AGGTCCTTGCGAGCT 3', Reverse: 5'GA AGATCT TCATCTAGAAAAAAGTAGGCCTTGA 3'. The amplified product was gel-cut and purified and ligated to the pEASY-T3 vector.
[0064] Transform into Escherichia coli DH5α, screen positive clones, and carry out PCR, enzyme digestion, and sequencing identification. Sequencing results show that its nucleotide sequence is the 1st-1545th nucleotide from the 5' end of Sequence 1 in the Sequence Listing, named atctpa2, which can encode the protein shown in Sequence 2, and the protein is named ATCTPA2, which will ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap