Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of protein ATCTPA2 related to photosynthesis

A protein and protein technology, applied in the biological field, can solve the problems such as no reports of Arabidopsis CtpA enzyme

Inactive Publication Date: 2013-09-11
INST OF BOTANY CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The enzyme has been successfully cloned in higher plants such as spinach and soybean, but so far there has been no report on the true CtpA enzyme in Arabidopsis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of protein ATCTPA2 related to photosynthesis
  • Application of protein ATCTPA2 related to photosynthesis
  • Application of protein ATCTPA2 related to photosynthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1, discovery process of gene function

[0042] 1. Identification of mutant materials

[0043] A mutant homozygous (salk_056011) for the T-DNA insertion of the nuclear-encoded gene At4g17740 located in the chloroplast was purchased from ABRC (Arabidopsis Biological Resource Center) in the United States. According to the protein structure domain and sequence comparison, the gene may be the The gene encoding CtpA is named AtctpA2, and the encoded protein is named ATCTPA2.

[0044] Mutant homozygous for T-DNA insertion and wild-type Arabidopsis (ordered in ABRC library, Col-0 type) were grown on MS medium with a growth light intensity of 40±5 μmol m -2 ·s -1 , the result is as figure 1 As shown, the left is wild-type Arabidopsis (WT), the right is the T-DNA insertion mutant homozygote (AtctpA2), and it is found that the cotyledons of the T-DNA insertion mutant homozygote are yellowed compared with wild-type Arabidopsis , light green true leaves, short plants...

Embodiment 2

[0061] Embodiment 2, transgene complementation experiment

[0062] 1. Acquisition of atctpa2 gene

[0063] The nucleotide sequence of the atctpa2 gene is sequence 1 in the sequence table, primers were designed according to the sequence between 1-1545bp, and amplified from the genome of Arabidopsis thaliana (Col-0 ecotype, purchased from the Arabidopsis Biological Resource Center) Gene. The primers used are as follows: Former: 5'CATG CCATGG AGGTCCTTGCGAGCT 3', Reverse: 5'GA AGATCT TCATCTAGAAAAAAGTAGGCCTTGA 3'. The amplified product was gel-cut and purified and ligated to the pEASY-T3 vector.

[0064] Transform into Escherichia coli DH5α, screen positive clones, and carry out PCR, enzyme digestion, and sequencing identification. Sequencing results show that its nucleotide sequence is the 1st-1545th nucleotide from the 5' end of Sequence 1 in the Sequence Listing, named atctpa2, which can encode the protein shown in Sequence 2, and the protein is named ATCTPA2, which will ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a protein ATCTPA2 related to photosynthesis, and provides an application of the coding gene of the protein ATCTPA2 to protecting the photosynthesis of a plant photosystem II, wherein the protein ATCTPA2 is a protein I which is composed of an amino acid sequence shown in a sequence 2 in the sequence table, or a protein II which is obtained by replacing the amino acid residue sequence in the sequence 2 in the sequence table with one or more amino acid residues, and / or eliminating and / or adding one or more amino acid residues, is provided with the same activity as the protein I, and is derived by the protein I. The experiment of the invention shows that the protein ATCTPA2 which is related to photosynthesis and is discovered from arabidopsis can recuperate etiolated seedling of an arabidopsis mutant with reduced ATCTPA2 expression into green seedling.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of a photosynthesis-related protein ATCTPA2. Background technique [0002] Photosynthesis is the process by which green plants, algae and photosynthetic bacteria use solar energy to synthesize carbon dioxide and water into energy-rich organic compounds. Chloroplasts are organelles that carry out photosynthesis in green plants and algae. The matrix and grana lamellar structures evolved from chloroplasts in higher plants are the main sites for photosynthesis. Four major complexes for photosynthetic electron transfer, namely photosystem I, photosystem II, and cytochrome b, are gathered on this type of sheet membrane. 6 f and the ATPase complex. Among the four major complexes, photosystem II is the first complex that functions in the electron transport chain, and in this complex, the core protein D1 encoded by the psbA gene that composes this complex is another A very...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/50C12N15/57A01H5/00
CPCY02A40/22Y02P60/40
Inventor 卢从明雷明温晓刚卢庆陶杨志攀杨辉霞丁顺华尹燕张爱红
Owner INST OF BOTANY CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More