Establishing method and application of paddy short-stalk strain, and method for recovering short stalk character
A technology for rice and dwarf stems, which is applied in the field of rice line creation, and can solve problems such as adverse pleiotropic effects, limiting the yield of bred varieties, and single genetic background of dwarf sources.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1, the method for the creation of rice dwarf strains
[0033] 1.1 Create dwt1 rice dwarf strains by genetic engineering or other means
[0034] The sequence of the coding region of the DWT1 gene in this example is shown in SEQ ID NO.3. The dwt1 mutant material in this example was obtained from the conventional japonica rice variety Wuyujing 7 (also known as 9522) through RNA interference or sequence variation of the DWT1 gene.
[0035] 1.2 Cloning of rice tiller plant height control protein gene
[0036] Utilize the group of rice gene positioning cloning (map-based cloning or position cloning) that comprises the tiller plant height control protein gene DWT1 and its mutant gene dwt1 that the inventor constructed, and is clear to those skilled in the art. Within small genome fragments, eg within 50Kb. On this basis, a genomic DNA clone containing the fragment was isolated by a conventional method. It was identified by enzyme digestion and further hybridiz...
Embodiment 2
[0056] Example 2, the use of dwt1 mutants in rice seed production
[0057] The dwt1 mutant was used as the male parent to cross the sterile parent in the three-line or two-line cross combination to obtain the F1 generation. In the F2 generation, the plants with both dwarf and sterile characteristics were screened, and the plants were crossed with the maintainer line corresponding to the original sterile parent. In the F2 generation, the plants with both dwarf and sterile characteristics were selected and crossed with the maintainer line. After multi-generation crossing and screening, a new dwarf sterile line was obtained, which was suitable as the female parent in the hybrid combination. In the practice of rice hybrid breeding, it is necessary to spray gibberellin on the male parent before the pollination season, so that the ear of the male parent is higher than that of the female parent, which can improve the efficiency of pollen transmission and hybridization. The dwt1 mu...
Embodiment 3
[0058] Embodiment 3, the method for recovering dwt1 mutant dwarf traits
[0059] Transferring the genomic nucleotide sequence encoding the DWT1 gene into the mutant dwt1 plant can restore the mutant to the wild-type phenotype.
[0060] Primers used from rice Nipponbare BAC clone (OsJNBb0063g05):
[0061] DWT-COM-F: 5' GCATGGGAATTCCGGTTTGACGCTTA CTGTGGT 3' and
[0062] DWT-COM-R: 5’CCTTAAGGTCACCTGGCGTTAAGCAAAATGATC AG 3’
[0063] A 6766bp genome sequence fragment of the DWT1 gene shown in SEQ ID NO.3 was amplified.
[0064] The fragment was inserted into the binary vector pCAMBIA1301 vector used for transformation of rice through EcoRI and BstEII; the sequencing verification was correct, and the vector was introduced into Agrobacterium tumefaciens EHA105 by electric shock to obtain Agrobacterium tumefaciens EHA105 (DWT-COM ) CGMCC No.4819, the Agrobacterium tumefaciens EHA105 has been deposited in the General Microbiology Center (CGMCC) of China Microbiological Culture Col...
PUM
| Property | Measurement | Unit |
|---|---|---|
| height | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More