Re-engineering mediated site-directed mutagenesis method

A site-directed mutagenesis and recombinase technology, applied in the field of genetic engineering, can solve the problems of inability to carry out extension, cumbersome operation, long time-consuming, etc., achieving good economic prospects and simplifying the operation.

Inactive Publication Date: 2013-01-16
NANJING NORMAL UNIVERSITY
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantage of this method is that the OE-PCR method sometimes cannot be extended, and it involves a series of gene cloning steps, that is, the operation steps of restriction endonuclease digestion, connection with expression vector, transformation of the connection product into expression host bacteria, etc.
[0006] Other methods such as the large primer method and the multiple oligonucleotide method are generally derived from the above methods, and have similar cloning steps, which are cumbersome to operate, time-consuming, and have a low mutation rate.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Re-engineering mediated site-directed mutagenesis method
  • Re-engineering mediated site-directed mutagenesis method
  • Re-engineering mediated site-directed mutagenesis method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1. Construction of nanA expression vector

[0043] Design primer AL1: 5'-GGG GGATCC ATGGCAACGAATTTACGTGGC-3', (SEQ ID NO. 1); AL2: 5'-GGG AAGCTT TCACCCGCGCTCTTGCATCAAC-3', (SEQ ID NO.2), respectively introduced BamHI and HindIII restriction sites are underlined. Using the genomic DNA of the original strain of Escherichia coli MG1655 as a template, the 0.9kb nanA gene was amplified from AL1-AL2, and the 0.9kb was digested with BamHI-HindIII and cloned into the BamHI-HindIII site of pET30a(+) to obtain E. coli aldolization Enzyme expression vector pLS2042.

Embodiment 2

[0044] Example 2 Site-directed mutation of nanA gene E192N

[0045] 1. Preparation and transformation of E. coli competent cells expressing the Red recombinase gene

[0046] Transform pLS2042 into LS-GR, and select with 25 μg / ml gentamycin and 30 μg / ml kanamycin to obtain strain LS-GR / pLS2042. Inoculate the single bacterium colony of gained bacterial strain to 3ml in the LB liquid culture medium that contains the gentamycin of 25 μ g / ml and the kanamycin of 30 μ g / ml, 37 o C Shake overnight, transfer 1 / 50 volume to 50 ml LB liquid medium of the same resistance, and shake to culture the cells to OD 600 At about 0.2, add L-arabinose at a final concentration of 0.2% to induce recombinase, and continue to culture until OD 600 About 0.4, pour the bacterial solution into a pre-cooled centrifuge tube, ice bath for 10 minutes, 4 o C, centrifuge at 5000rpm for 5 minutes, discard the supernatant. Wash the pellet twice with ice-cold 10% glycerol, and finally suspend in 200...

Embodiment 3

[0057] Example 3. Site-directed mutation of nanA gene S208G

[0058] Design primer R555: 5'-cgaaatcttcgcctctggtctgctggcgggcgctgatggtggtatcggc G GTACCTACAACATCATGGGCTG -3', (SEQ ID NO.10), in this primer, the 50bp homology arm upstream of the target site is indicated by lowercase letters, the mutation site is indicated by italic letters, and the amplification primer is indicated by underlined letters; R563:5 '-ACGAAATCTTCGCCTCTGGTC-3', (SEQ ID NO.11), R563 is the sequence of about 21 bases at the front of R555. The primer R552 for amplifying the nanA gene fragment, the primers R553 and R554 for amplifying bla, the downstream short amplification primer R561 and the sequencing primer R566 are all the same as those in the E192N facility example. R555 and R552 respectively correspond to figure 1 P1 and P2 in, R553 and R554 respectively correspond to figure 1 P3 and P4, R56 and R562 respectively correspond to figure 1 P5 and P6 in.

[0059] Using pLS2042 as a templ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a site-directed mutagenesis method based on re-engineering. Firstly, a downstream segment, another resistant gene and a DNA (deoxyribose nucleic acid) modification segment are obtained by the aid of overlap-extension polymerase chain reaction, the downstream segment contains a left-end 50bp homologous arm, a mutagenesis site and a target gene mutagenesis site, the left-end 50bp homologous arm is consistent with an upstream 50bp sequence of a target site to be mutated, the target site to be mutated is cloned on a plasmid, the another resistant gene contains a resistant gene different from that of the plasmid, and the DNA modification segment with a right-end 50bp homologous arm is positioned on the downstream of a resistant gene of a carrier. Secondly, the integrated segment is electrically transformed in Escherichia coli expressing recombinase and containing the plasmid with a cloned target gene, and the target site with site-directed mutagenesis and recombinant clone with the resistant gene on the original plasmid replaced by the resistant gene carried on the modification segment are obtained by means of recombinase mediated homologous recombination.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to an efficient method for realizing site-directed mutation by means of recombination engineering. Background technique [0002] Site-directed mutagenesis refers to the use of molecular biology methods to change an amino acid at a specific site of a protein into another amino acid. Since it is very difficult to directly manipulate the protein, the base is first changed at the gene (DNA) level, and the mutated gene codes for the mutated protein. Site-directed mutagenesis is an important way to study the structure and function of genes and proteins and to obtain high-quality catalytic enzymes. It is a common means of molecular biology research. [0003] Since the Kunkel method of site-directed mutagenesis using dUTPase-deficient strains, a variety of methods for site-directed mutagenesis of genes cloned on vectors have been developed, and the following two methods are commonly used...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/09C12R1/19
Inventor尚广东樊丹凌文石牡丹
OwnerNANJING NORMAL UNIVERSITY