Recombinant human prion protein (hPrP), and preparation method and application thereof
A protein and human prion technology, which is applied to the application of recombinant human prion protein hPrP in the detection of prion diseases, recombinant expression vector, recombinant human prion protein hPrP and its encoding gene and the field of preparation, which can solve the problem that the precise amino acid site cannot be satisfied. Research work and other issues to achieve good specificity and immunoreactivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Embodiment 1 Construction of recombinant expression vector pPROEX-htb-hPrP
[0055] 1. PCR amplification of human prion protein polypeptide gene (hPrPc gene)
[0056] Primer: Upstream: cgcGGATCC CAAGAAGCGCC CGAAGC (the underlined part is the protected base and BamH I, restriction site), downstream: cccAAGCTT Primers ACGATCCTCTCTGGTAATAGG CC (the underlined part is the protected base and Hind III restriction site) were synthesized by Shanghai Sangon Bioengineering Technology Co., Ltd.
[0057] Template: human whole blood (blood collected from healthy people in the physical examination center) gene as a template (the whole blood gene extraction kit used was purchased from Dingguo Biotechnology Co., Ltd.).
[0058] PCR system and conditions:
[0059] A high-fidelity PCR kit (Quanshijin Biotechnology Co., Ltd.) was used for PCR amplification, and the total volume of the reaction system was 50 μL. reaction system:
[0060]
[0061] Reaction conditions:
[0062] Pre...
Embodiment 2
[0078] Expression, purification and renaturation of embodiment 2 recombinant human prion protein hPrP
[0079] 1. Induced expression of human prion protein
[0080]The pPROEX-htb-hPrP prepared in Example 1 was transformed into BL21 competent cells, and after the sequence analysis was correct, the species was preserved to obtain the engineering bacteria expressing human prion protein.
[0081] Inoculate the constructed human prion engineering bacteria into 20 mL of LB medium containing 50 mg / mL ampicillin for overnight culture (about 18 hours), inoculate 2 L of LB liquid medium containing 50 mg / mL ampicillin at an amount of 1%, Cultivate at 200rpm at 37°C until OD in the logarithmic phase of bacterial growth 600 =0.4~0.6. Add IPTG to make the final concentration 1mmol / L, culture at 160rpm at 37°C, and collect the bacterial liquid after 6h. Take 1 mL of expressing bacteria and centrifuge, add 30 μL of PBS to the pellet for suspension, and then add 30 μL of loading buffer (rec...
Embodiment 3
[0087] Identification of embodiment 3 recombinant human prion protein hPrP
[0088] After the recombinant human prion protein hPrP was successfully expressed, SDS-PAGE and Western-Blot tests were carried out to determine whether the target recombinant protein was obtained.
[0089] 1. SDS-PAGE detection: 20 microliters of the repurified human prion protein hPrP was mixed evenly with the same volume of 2× loading buffer, boiled in boiling water for 10 minutes to fully denature the protein, and then centrifuged at 10,000 rpm for 1 minute. Put the prepared gel into the vertical electrophoresis tank according to the instructions, and pour an appropriate amount of SDS-PAGE electrophoresis buffer; carefully add protein markers and samples to the SDS-PAGE gel holes in order, 10 microliters / well, protein marker . Electrophoresis at a voltage of 90V for about 30min until the blue BPB in the sample is taken through the stacking gel, then the voltage is adjusted to 120V until the sample...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 