Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant human prion protein (hPrP), and preparation method and application thereof

A protein and human prion technology, which is applied to the application of recombinant human prion protein hPrP in the detection of prion diseases, recombinant expression vector, recombinant human prion protein hPrP and its encoding gene and the field of preparation, which can solve the problem that the precise amino acid site cannot be satisfied. Research work and other issues to achieve good specificity and immunoreactivity

Inactive Publication Date: 2013-01-23
CHINA AGRI UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these expression technologies all have a shortcoming in the construction of the vector: after the target fragment is connected to the expression vector by double restriction technology, the upstream restriction site (restriction site for constructing the vector and additional restriction site) If it is not removed, it will be translated together with the target gene, and the N-terminus of the target protein will have a few more amino acids (≥2). Such a protein may have a certain impact in general research, such as the preparation of corresponding antibodies. , and in the process of research on the mechanism of prion protein resistance, the research work on the precise amino acid position cannot be satisfied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human prion protein (hPrP), and preparation method and application thereof
  • Recombinant human prion protein (hPrP), and preparation method and application thereof
  • Recombinant human prion protein (hPrP), and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Embodiment 1 Construction of recombinant expression vector pPROEX-htb-hPrP

[0055] 1. PCR amplification of human prion protein polypeptide gene (hPrPc gene)

[0056] Primer: Upstream: cgcGGATCC CAAGAAGCGCC CGAAGC (the underlined part is the protected base and BamH I, restriction site), downstream: cccAAGCTT Primers ACGATCCTCTCTGGTAATAGG CC (the underlined part is the protected base and Hind III restriction site) were synthesized by Shanghai Sangon Bioengineering Technology Co., Ltd.

[0057] Template: human whole blood (blood collected from healthy people in the physical examination center) gene as a template (the whole blood gene extraction kit used was purchased from Dingguo Biotechnology Co., Ltd.).

[0058] PCR system and conditions:

[0059] A high-fidelity PCR kit (Quanshijin Biotechnology Co., Ltd.) was used for PCR amplification, and the total volume of the reaction system was 50 μL. reaction system:

[0060]

[0061] Reaction conditions:

[0062] Pre...

Embodiment 2

[0078] Expression, purification and renaturation of embodiment 2 recombinant human prion protein hPrP

[0079] 1. Induced expression of human prion protein

[0080]The pPROEX-htb-hPrP prepared in Example 1 was transformed into BL21 competent cells, and after the sequence analysis was correct, the species was preserved to obtain the engineering bacteria expressing human prion protein.

[0081] Inoculate the constructed human prion engineering bacteria into 20 mL of LB medium containing 50 mg / mL ampicillin for overnight culture (about 18 hours), inoculate 2 L of LB liquid medium containing 50 mg / mL ampicillin at an amount of 1%, Cultivate at 200rpm at 37°C until OD in the logarithmic phase of bacterial growth 600 =0.4~0.6. Add IPTG to make the final concentration 1mmol / L, culture at 160rpm at 37°C, and collect the bacterial liquid after 6h. Take 1 mL of expressing bacteria and centrifuge, add 30 μL of PBS to the pellet for suspension, and then add 30 μL of loading buffer (rec...

Embodiment 3

[0087] Identification of embodiment 3 recombinant human prion protein hPrP

[0088] After the recombinant human prion protein hPrP was successfully expressed, SDS-PAGE and Western-Blot tests were carried out to determine whether the target recombinant protein was obtained.

[0089] 1. SDS-PAGE detection: 20 microliters of the repurified human prion protein hPrP was mixed evenly with the same volume of 2× loading buffer, boiled in boiling water for 10 minutes to fully denature the protein, and then centrifuged at 10,000 rpm for 1 minute. Put the prepared gel into the vertical electrophoresis tank according to the instructions, and pour an appropriate amount of SDS-PAGE electrophoresis buffer; carefully add protein markers and samples to the SDS-PAGE gel holes in order, 10 microliters / well, protein marker . Electrophoresis at a voltage of 90V for about 30min until the blue BPB in the sample is taken through the stacking gel, then the voltage is adjusted to 120V until the sample...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant human prion protein (hPrP), and a preparation method and application thereof. The amino acid sequence of the recombinant hPrP is shown as SEQ ID NO.2. The preparation method comprises the following steps: obtain an hPrP DNA (deoxyribonucleic acid) sequence having enzyme cutting sites through a PCR (polymerase chain reaction) method by taking a human whole blood gene as the template and using primers of which the nucleotide sequences are shown as SEQ ID NO.3 and SEQ ID NO.4; connecting the hPrP DNA sequence to a pPROEX-htb plasmid; removing unwanted enzyme cutting sites in front of a target gene in an expression carrier through a site-directed mutagenesis technology to obtain an hPrP fully true expression carrier; and performing expression, overhigh-affinity chromatographic column purification and renaturation on the carrier in Escherichia coli to obtain the recombinant hPrP. The recombinant hPrP obtained by the invention has good biological activity, and can be used for developing hPrP polyclonal antibodies, monoclonal antibodies and diagnosis kits for human prion diseases.

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular to a recombinant human prion protein hPrP and its encoding gene and preparation method, as well as the application of a recombinant expression vector containing the encoding gene and recombinant human prion protein hPrP in the detection of prion diseases . Background technique [0002] Prion disease, also known as transmissible spongiform encephalopathies (TSEs), is a fatal neurodegenerative disease characterized by brain vacuolation, neuronal death, and microglial proliferation. [0003] Prion protein is closely related to the occurrence of transmissible spongiform encephalopathy. Therefore, recombinant prion protein is essential for the research and development of diagnostic reagents and pathogenesis of this disease. The current method for obtaining recombinant prion protein is to construct a prion protein expression vector through genetic engineering technology, express the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/47C07K1/16C12N15/12C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12N15/66G01N33/68
Inventor 杨利峰赵德明杨秀进王伊琴宋志琦姚皓周向梅尹晓敏张爽
Owner CHINA AGRI UNIV