Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of protein coded by gene LIMG and antibody thereof in breast cancer diagnosis and/or treatment

A protein, breast cancer technology, applied in the determination/inspection of peptide/protein components, antibodies, microorganisms, etc., to achieve the effect of simple detection methods

Inactive Publication Date: 2013-03-06
北京艾吉生物科技有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In the report of prior art, also do not have the report of the function of this gene and its coded protein, in order to further study the function of this gene and its coded protein, inventor has carried out in-depth research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of protein coded by gene LIMG and antibody thereof in breast cancer diagnosis and/or treatment
  • Application of protein coded by gene LIMG and antibody thereof in breast cancer diagnosis and/or treatment
  • Application of protein coded by gene LIMG and antibody thereof in breast cancer diagnosis and/or treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1: Preparation of LIMG antibody:

[0031] BL21 Escherichia coli cells were used to express and purify LIMG-GST protein, and this protein was used to prepare specific LIMG polyclonal antibody and in vitro protein function detection:

[0032] First, the LIMG fragment was amplified by PCR, and then the target fragment was recovered by agarose gel electrophoresis, followed by enzyme digestion and overnight ligation, and the LIMG fragment was cloned into the pGEX4T3 plasmid, and the LIMG / pGEX4T3 plasmid was transformed into Escherichia coli BL21 cells , using the classic IPTG-induced protein expression method to induce the expression of the target protein, and then lyse Escherichia coli and use GST-beads to purify the LIMG-GST fusion protein.

[0033] LIMG / pGEX4T3 plasmid synthesis method:

[0034] pGEX-4T3 was purchased from Amersham Biosciences, and specific primers were designed to amplify LIMG truncated gene fragments based on the full-length LIMG gene sequen...

Embodiment 2

[0046]Example 2: Breast tumors: LIMG is highly expressed in human breast tumors

[0047] We detected the expression of LIMG at the RNA and protein levels in normal breast cell lines and breast tumor cell lines, and found that the expression of LIMG in tumor cells was higher than normal. We detected the differences in RNA levels by extracting RNA from remote normal tissues of 24 patients and 22 tumor tissues by RT-PCR, and found that the expression of LIMG in tumor tissues of most patients was higher than normal. And it is related to the grade of tumor malignancy.

[0048] RNA level detection adopts the method of realtime PCR. The specific conditions of RT-PCR: primers, system, cycle temperature and time are as follows:

[0049] The nucleotide sequence of the upstream primer is shown in SEQ NO ID: 3,

[0050] The nucleotide sequence of the downstream primer is shown in SEQ NO ID: 4;

[0051] SEQ NO ID: 3: 5'CTTGTCCATTTCTCAGCGACA 3'

[0052] SEQ NO ID: 4: 5'ACTCCTCTCACACCCAC...

Embodiment 3

[0057] Example 3: mammary gland development

[0058] The expression of LIMG gene is also significantly increased during the mammary gland proliferation process of pregnant mice. The experimental procedure is as follows:

[0059] Collect ICR female mice at 6-8 weeks, 6.5 days of pregnancy, 12.5 days of pregnancy, 18.5 days of pregnancy, 3 days of lactation, 10 days of lactation, and 24 days of lactation, 5 at each stage, cut open Under the skin, the mammary gland tissue was completely taken out, the mammary gland tissue was ground with liquid nitrogen, and then the tissue RNA was extracted by the trizol method. At the same time, OCT was used to make frozen sections, and subsequent real-time PCR detection and immunohistochemical detection were performed respectively. The detection methods were the same as in Example 2; The histogram of the change in the expression level of the LIMG gene during the development of the mouse mammary gland is obtained by statistics. Figure 5 shown...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a protein coded by gene LIMG and an antibody thereof, and specifically relates to an application of the protein coded by gene LIMG and the antibody thereof in mammary gland diagnosis and / or treatment. According to the invention, gene LIMG expression is detected by using a quantitative PCR method, and detection is carried out by using a quantitative PCR instrument. When a gene LIMG level to be detected is higher by 1.95-2.05 times that of a normal reference group gene LIMG level, it is determined as positive. When the protein coded by LIMG is detected by using an ELISA immunoassay method, when the level of the gene-LIMG-coded protein to be detected is higher by 1.95-2.05 times that of a normal reference group gene LIMG level, it is determined as positive. The invention also relates to applications of the gene LIMG, the protein coded by the gene, and the antibody thereof in breast enhancement and in mammary gland development detection.

Description

technical field [0001] The present invention relates to the protein encoded by gene LIMG and its antibody, specifically, the application of the protein encoded by gene LIMG and its antibody in the diagnosis and / or treatment of breast cancer. Background technique [0002] The LIMG gene is located on the long arm of human chromosome 9, with a total length of 453 bases, consisting of 5 exons and 4 introns. The ORF of LIMG we cloned has 453 bases, encoding a protein of 150 amino acids, with a predicted molecular weight of 17kDa. figure 1 It is a schematic diagram of the gene structure of LIMG. The ORF of the LIMG gene is 150 amino acids, the underlined part is the EF-hand (52-112aa) domain, and the protein sequence of LIMG is shown below. [0003] In the reports of the prior art, there is no report on the function of the gene and its encoded protein. In order to further study the function of the gene and its encoded protein, the inventors conducted in-depth research. Contents...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68G01N33/68G01N33/574A61K39/395A61P35/00A61K45/00A61K38/17A61P15/14
Inventor 李凌松
Owner 北京艾吉生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More