Application of protein coded by gene LIMG and antibody thereof in breast cancer diagnosis and/or treatment
A protein, breast cancer technology, applied in the determination/inspection of peptide/protein components, antibodies, microorganisms, etc., to achieve the effect of simple detection methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Embodiment 1: Preparation of LIMG antibody:
[0031] BL21 Escherichia coli cells were used to express and purify LIMG-GST protein, and this protein was used to prepare specific LIMG polyclonal antibody and in vitro protein function detection:
[0032] First, the LIMG fragment was amplified by PCR, and then the target fragment was recovered by agarose gel electrophoresis, followed by enzyme digestion and overnight ligation, and the LIMG fragment was cloned into the pGEX4T3 plasmid, and the LIMG / pGEX4T3 plasmid was transformed into Escherichia coli BL21 cells , using the classic IPTG-induced protein expression method to induce the expression of the target protein, and then lyse Escherichia coli and use GST-beads to purify the LIMG-GST fusion protein.
[0033] LIMG / pGEX4T3 plasmid synthesis method:
[0034] pGEX-4T3 was purchased from Amersham Biosciences, and specific primers were designed to amplify LIMG truncated gene fragments based on the full-length LIMG gene sequen...
Embodiment 2
[0046]Example 2: Breast tumors: LIMG is highly expressed in human breast tumors
[0047] We detected the expression of LIMG at the RNA and protein levels in normal breast cell lines and breast tumor cell lines, and found that the expression of LIMG in tumor cells was higher than normal. We detected the differences in RNA levels by extracting RNA from remote normal tissues of 24 patients and 22 tumor tissues by RT-PCR, and found that the expression of LIMG in tumor tissues of most patients was higher than normal. And it is related to the grade of tumor malignancy.
[0048] RNA level detection adopts the method of realtime PCR. The specific conditions of RT-PCR: primers, system, cycle temperature and time are as follows:
[0049] The nucleotide sequence of the upstream primer is shown in SEQ NO ID: 3,
[0050] The nucleotide sequence of the downstream primer is shown in SEQ NO ID: 4;
[0051] SEQ NO ID: 3: 5'CTTGTCCATTTCTCAGCGACA 3'
[0052] SEQ NO ID: 4: 5'ACTCCTCTCACACCCAC...
Embodiment 3
[0057] Example 3: mammary gland development
[0058] The expression of LIMG gene is also significantly increased during the mammary gland proliferation process of pregnant mice. The experimental procedure is as follows:
[0059] Collect ICR female mice at 6-8 weeks, 6.5 days of pregnancy, 12.5 days of pregnancy, 18.5 days of pregnancy, 3 days of lactation, 10 days of lactation, and 24 days of lactation, 5 at each stage, cut open Under the skin, the mammary gland tissue was completely taken out, the mammary gland tissue was ground with liquid nitrogen, and then the tissue RNA was extracted by the trizol method. At the same time, OCT was used to make frozen sections, and subsequent real-time PCR detection and immunohistochemical detection were performed respectively. The detection methods were the same as in Example 2; The histogram of the change in the expression level of the LIMG gene during the development of the mouse mammary gland is obtained by statistics. Figure 5 shown...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com