Protein associated with hexose transport and coding gene and application thereof

A gene and hexose technology, which is applied to proteins related to hexose transport and its coding genes and application fields, can solve the problems of gene cloning, function and research that have not been found for monosaccharide transporters, and achieve the improvement of quality and quality. Yield effect

Active Publication Date: 2013-04-17
CHINA AGRI UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the physiological and biochemical characteristics of cucumber and the changes of related indicators under various stress conditions have been extensively studied, there is no research on the cloning and function of the genes related to the monosaccharide transporter in cucumber. The function and localization of sugar transporter genes help to clarify the mechanism of sugar metabolism in cucumber

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein associated with hexose transport and coding gene and application thereof
  • Protein associated with hexose transport and coding gene and application thereof
  • Protein associated with hexose transport and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1. Acquisition of cucumber hexose transport-related protein and its coding gene

[0038] Sow the seeds of cucumber variety Guonong No. 25 (Department of Vegetables, China Agricultural University) in a mixed substrate with peat, vermiculite and field soil (volume ratio 1:1:1), and wait until the plants grow to 3-5 leaves Time-fixed values ​​were placed in the solar greenhouse, under routine management, and 6 samples of roots, stems, leaves, petioles, flowers, and fruits were taken after the plants bloomed and bear fruit, and total RNA was extracted respectively by the TRIzol method, and reverse transcriptase (M -MLV) was reverse transcribed to obtain the first strand of cDNA. Using these cDNAs as templates, PCR was designed based on a possible monosaccharide transporter cDNA sequence compared with the cucumber genome database of the Chinese Academy of Agricultural Sciences (http: / / cucumber.genomics.org.cn / page / cucumber / index.jsp) Primers 5'-ATGGCGGGAGGTGGATTTGTT...

Embodiment 2

[0040] Example 2. Verification and analysis of the transport function of cucumber hexose transporter CsHT1 in yeast

[0041] 1. Construction of recombinant expression vector pDR196-CsHT1

[0042] Using the pGEM-T:CsHT1 recombinant plasmid obtained in Example 1 as a template, design primers, wherein the upstream primer is 5'-CCG GAATTC ATGGCGGGAGGTGGATTTGTTTCT (the dashed part is the EcoR I restriction site), the downstream primer is 5'-ACGC GTC GAC TCAGACACCTTTGCCATACGGCTCCATACT (the part underlined is the restriction site of Sal I), and the CsHT1 gene with restriction sites EcoR I and Sal I in the upstream and downstream were amplified by PCR. Then the above-mentioned amplified CsHT1 gene fragment, together with pDR196 (Ren-Chun Fan, Chang-Cao Peng et al (2009) Apple SucroseTransporter SUT 1and Sorbitol TransporterSOT6 Interact with Cytochrome b5 to Regulate Their Affinity for Substrate Sugars.Plant Physiol. Vol.150) vector was cut with the same restriction endonuclease E...

Embodiment 3

[0072] Embodiment 3, expression analysis of CsHT1 gene in different tissues of cucumber

[0073] At noon on a sunny day, the roots, stems, leaves, petioles, flowers, and fruits of cucumber Guonong No. 25 grown to the early melon stage were selected, and the total RNA was extracted by TRIzol method, and the RNA was detected by 1% agarose gel electrophoresis. integrity. Using the total RNA of the above-mentioned roots, stems, leaves, petioles, flowers, and fruits as templates, reverse transcribe to obtain the first cDNA strand, and use the cDNA strand as a template to perform PCR amplification with the following two primers:

[0074] 5'-ATGGCGGGAGGTGGATTTGTTTC and

[0075] 5'-TCAGACACCTTTGCCATACGGTCTCATACT-3', and 18s rRNA was used as an internal control for expression analysis.

[0076] The result is as figure 1 As shown, this result indicated that the CsHT1 gene could only be detected in cucumber flowers.

[0077]

[0078]

[0079]

[0080]

[0081]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses protein associated with hexose transport and a coding gene and an application thereof. The protein provided by the invention is the following 1) or 2): 1) protein composed of an amino acid sequence shown in sequence 2 in the sequence table; 2) protein which is obtained by substitution, deletion or addition of one or more amino acid residues of the amino acid residue sequence in the sequence 2 in the sequence table, is associated with hexose transport, and is derived from 1). Experiments prove that the CsHT1 protein provided by the invention can recover the glucose absorption function of yeast mutant with hexose transport defects, which proves that the cucumber hexose carrier protein CsHT1 has the glucose absorption function. These results show that the protein CsHT1 associated with hexose transport and the coding gene thereof can be used for regulating glycometabolism in cucumbers, and improving cucumber quality, and are widely applicable to research of glycometabolism in plants.

Description

technical field [0001] The invention relates to a protein related to hexose transport, its coding gene and application. Background technique [0002] In recent years, my country's vegetable industry has developed rapidly. According to statistics from the Ministry of Agriculture, in 2005, the country's vegetable sown area was 17.7207 million hectares, with a total output of 564.5149 million tons and a per capita share of 432kg. According to the statistics of the Food and Agriculture Organization of the United Nations (FAO), in 2005 my country's vegetable sown area and output both ranked first in the world, wherein the vegetable sown area accounted for 43% of the world, and the total output accounted for 49% of the world. At present, my country's vegetable sown area accounts for more than one-third of the world's total vegetable sown area, and its output accounts for about 50% of the world's total output. It is the country with the largest vegetable sown area and the largest o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N1/19C12N15/81C12N15/11
Inventor眭晓蕾成金桃王振雨张振贤
OwnerCHINA AGRI UNIV