Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method for oral hypoglycemic recombinant human proinsulin

A recombinant human insulin, human insulin technology, applied in the direction of insulin, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of complex separation and purification process of human proinsulin, and achieve simple and rapid preparation methods and separation processes. Production prices, effects of reducing negative effects and mental distress

Inactive Publication Date: 2013-04-17
JIANGSU UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The invention of this product overcomes the current limitation that human insulin is derived from pancreatic tissue extraction, and also overcomes the shortcomings of the complicated separation and purification process of human proinsulin produced by recombinant yeast fermentation, and has a good application prospect in the field of pharmacy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method for oral hypoglycemic recombinant human proinsulin
  • Preparation method for oral hypoglycemic recombinant human proinsulin
  • Preparation method for oral hypoglycemic recombinant human proinsulin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Cloning, sequencing and identification of human proinsulin hpi gene

[0038] The gene of human proinsulin HPI was amplified from the plasmid pDNR-LIB (Protein Group, Inc.) purchased by the company by PCR.

[0039]The PCR amplification primers of human proinsulin hpi gene fragment are:

[0040] hpi-F: CATGCCATGGCTATGGCCCTGTGGATGCG (SEQ ID NO. 1)

[0041] hpi-R: CGAGCTCCTAGTTGCAGTAGTTTCCAGCTG (SEQ ID NO. 2)

[0042] The PCR reaction system was carried out strictly according to the instruction manual of TaKaRa LA Taq. The 20 μL reaction system contained 0.2 μL of TaKaRa LA Taq, 10×LA PCR Buffer Ⅱ (Mg 2+ Plus) 2μL, dNTP Mixture (2.5mM each) 3.2μL, template DNA 100ng, upstream and downstream primers (20μM) 0.4μL, and finally add sterilized ultrapure water to make up to 20μL. The PCR conditions are: denaturation at 94°C for 5 minutes, 1 minute at 94°C, 40s at 56°C, and 40s at 72°C, 30 cycles. The size of the PCR product is 352bp, including the coding sequence o...

Embodiment 2

[0044] Example 2: Preparation and application of Bacillus subtilis recombinant spores displaying HPI on the surface of the carrier using CotC

[0045] 1. Construction of recombinant integrative plasmid pJS700-HPI

[0046] Plasmid pJS700 (Li Qian. Study on recombinant spores of Bacillus subtilis displaying WSSV envelope proteins Vp19 and Vp28 on the surface of CotX [D]. Zhenjiang, Jiangsu: Jiangsu University, 2010:36-38) was provided by Ningde, School of Environment, Jiangsu University Donated by Associate Professor Gang, the size of the plasmid is about 5.5kb. In the pJS700 plasmid, amyE5'-end and amyE3'-end respectively represent the 5' end and 3' end of the coding sequence of the amylase gene amyE (Gene Bank sequence number: NP_388186), which are integrated into Bacillus subtilis 168 (trp - ) in the amylase gene of the chromosome. Amps r ,Em r Represent ampicillin resistance gene and erythromycin resistance gene respectively, in Escherichia coli and Bacillus subtilis 168...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a product, a preparation method and an application of oral hypoglycemic recombinant human proinsulin. A bacillus subtilis spore capsid protein gene is taken as a molecular carrier and recombined with a human proinsulin gene to form an integral recombinant plasmid of fusion expression with an enterokinase label, bacillus subtilis is transformed a bacillus subtilis recombination strain is obtained, the recombination strain is induced to generate a recombination spore, and the human proinsulin is displayed on the surface of the spore. The bacillus subtilis recombination strain is successfully screened out, and the human proinsulin is displayed on the surface of the spore generated by inducing the recombination strain. The recombination spore can be directly used for intestinal digestion and absorption of animals in an oral administration way, and the partial drug effect and the nutritional function of the human proinsulin are achieved at the same time on the basis of keeping the physiological property of the spore. Meanwhile, the oral hypoglycemic recombinant human proinsulin is suitable for industrial production.

Description

technical field [0001] The invention relates to a preparation method and product of recombinant spores displaying foreign proteins on the surface, specifically refers to displaying human proinsulin HPI recombinant spores with an enterokinase tag on the surface of Bacillus subtilis spores, belonging to the technical field of recombinant fusion protein drugs. Background technique [0002] Human proinsulin (HPI) is a single-chain aglycosylated protein composed of 109 amino acids, with a molecular weight of about 12kD (Bell GI, et al.1979. Kyriazis GA, et al.2012), and its isoelectric point Around 5.2. HPI is the precursor protein of the only hypoglycemic hormone insulin in the human body. Both in vivo and in vitro studies have found that it can effectively reduce the glycogenolysis stimulated by glucagon, and bind to insulin receptors to exert biological effects. The long-term imbalance of insulin levels in the human body is likely to cause diabetes. With the continuous develo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N1/21C12N15/62C07K14/62A61K38/28A61P3/10C12R1/125
Inventor 陈克平冯凡胡平连超群吕鹏唐琪姚勤袁弋张春霞陈亮
Owner JIANGSU UNIV