Molecular motor biosensor kit for detecting salmonella
A technology of biotin and biotin labeling, which is applied in the direction of microorganism-based methods, microorganisms, and the determination/inspection of microorganisms. It can solve problems such as time-consuming and labor-intensive, increasing laboratory workload, affecting product quality and shelf life, etc. Achieve high-throughput detection, high sensitivity, and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0007] The specific nucleic acid probe 5'gtgaaattatcgccacgttcgggcaa was designed according to the Salmonella invA gene, wherein the 5' of the probe was labeled with biotin. The probe is connected to the molecular motor through the biotin antibody, and the DNA of the sample to be tested can be detected by using the molecular motor biosensor. When the sample is Salmonella DNA, the fluorescence value of the detection system will change significantly. Through this Changes can be used to judge the sample as positive. For this reason, we have designed a kit that can detect Salmonella in food conveniently and quickly.
[0008] Kit composition:
[0009] Numbering
[0010] The operation steps are as follows:
[0011] 1. Take a 1.5ml EP tube and add 10μl of the sample to be tested.
[0012] 2. Put the above EP tube into boiling water for 3 minutes, then immediately transfer to ice to cool down completely.
[0013] 3. Take 2μl of chro invA and dilute to a certain multiple ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com