Interest protein preparation method and purpose thereof

A technology of purpose and protein, applied in the field of preparation of target protein

Active Publication Date: 2013-06-05
SINOBIOWAY BIOMEDICINE
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the main problems are how to improve the expression, easy to purify and maintain good biological activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Interest protein preparation method and purpose thereof
  • Interest protein preparation method and purpose thereof
  • Interest protein preparation method and purpose thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1: Cloning of Huwen analgesic peptide gene.

[0058] 1. Design of oligonucleotide fragment of Huwen analgesic peptide gene

[0059] According to the preference of Pichia pastoris to codons, the gene encoding the mature peptide of Huwen analgesic peptide was optimized. Without changing the amino acid sequence, the codons used frequently by Pichia pastoris were used to replace rare codons. There are 4 Oligos, each of which has 15-16 bases complement each other. Oligo is synthesized by Invitrogen Biotechnology Co., Ltd.

[0060] Oligo1: AT GAATTC GCTTGTAAGGGTGTC (SEQ ID NO:1) where the single underlined line is the EcoR I restriction site, the double underlined line is the BglII restriction site, and the single underlined wavy line is the yeast kex2 restriction site.

[0061] Oligo2: GTTTGGACAACACTCGTTCTTACCTGGAGTACAAGCGTCGAAGACACCCTTACAAGC (SEQ ID NO: 2)

[0062] Oligo3: GAGTGTTGTCCAAACAGAGTTTGTTCTGACAAGCACAAGTGGT GTAAGTGGAAGTTG (SEQ ID NO: 3)

[0063] Oligo4: TAT GCGG...

Embodiment 2

[0071] Example 2: Eukaryotic expression and purification of the multi-copy directional cloning construct of Huwen analgesic peptide gene

[0072] 1. Yeast expression of multi-copy directional cloning construct of Huwen analgesic peptide gene

[0073] Plasmid PUC57-HWAP-I-PUC57-8HWAP-I containing the Huwen analgesic peptide 1-8 tandem gene was digested with EcoR I / NotI and the Huwen analgesic peptide 1-8 tandem gene was recovered, and the recovered fragment By T 4 The ligase was ligated to the pPIC9K vector (preserved in our laboratory) recovered after the double digestion with EcoR I / NotI, the ligation mixture was transformed into E. coli DH5α, and the transformed bacteria solution was spread on LB plates containing kanamycin Incubate at 37°C for 14-16h for culture screening. Perform PCR detection on the positive clones selected first, and see the results Figure 9-11 . among them Picture 9 Lane M is a DNA marker; Lane 1 is empty pPIC9K; Lanes 2-9 are PCR results of positive clo...

Embodiment 3

[0084] Example 3: Study on the activity of Huwen analgesic peptide monomer product

[0085] The biological activity of the recombinant Huwen analgesic peptide was detected by the thermal radiation-tail-flicking pain test of epidural medication in SD rats. Refer to Zhang Yong's method (Zhang Yong's doctoral dissertation, The role of acupuncture in the treatment of chronic neuropathic pain and its primary sensory nerve mechanism, 1999, April, Tongji Medical University). SD rats were purchased from the Animal Center of Xiamen University School of Medicine. The activity test results show that the recombinant Huwen analgesic peptide obtained in the above steps has a certain analgesic effect and a certain positive dose-effect relationship.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an interest protein preparation method and a purpose of the interest protein preparation method. The interest protein preparation method comprises the steps of obtaining interest protein nucleotide sequence fragments, constructing interest protein recombinant expression vectors, expressing interest protein in an inducible mode, purifying the interest protein and cutting purified products. The fronts of the interest protein nucleotide sequence fragments are inserted into monomer cutting recognition sites. Preferably, the upper streams of the interest protein nucleotide sequence fragments are introduced into kex2 enzyme cutting sites, and the down streams of the interest protein nucleotide sequence fragments are introduced into hydroxylamine hydrochloride enzyme cutting sites. The interest protein is obtained through sequence of event (SOE) technology, and is introduced into monomer cutting recognition sites through primers. The interest protein can be human nerve growth factors such as thymosin, tiger stripe pancreatic polypeptide and tiger stripe analgesic peptide. By adopting the interest protein preparation method, obtained interest protein is high in expression quality and easy to purify. Genetic expression products are interest protein monomer, no extra amino acid residue is carried, and thus not only is the good biology activity of interest protein products ensured, but also multicopy cutting cost is saved, the purification is simple and the mass production is facilitated.

Description

【Technical Field】 [0001] The invention relates to genetic engineering technology, in particular to a method for preparing a target protein and its use. 【Background technique】 [0002] With the development of genetic engineering technology, some small molecular peptides with biological activity, such as Huwen Analgesic Peptide, have received great attention. Huwen Analgesic Peptide is a polypeptide composed of 33 amino acids extracted from the unique Huwen spider venom in my country. Animal experiments have shown that Huwen Analgesic Peptide has a very strong analgesic effect, its mechanism and location are completely different from morphine, and it has the characteristics of non-addiction and non-dependence. It is expected to be developed as a new analgesic to replace morphine, especially for the pain treatment of cancer patients and patients after surgery. [0003] At present, the preparation of active polypeptides mostly adopts chemical synthesis or biological tissue extraction...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/81C07K14/435A61K38/17A61P25/04
Inventor 任宏伟凡复林昳章永垒梁洁
Owner SINOBIOWAY BIOMEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap