Interest protein preparation method and purpose thereof
A technology of purpose and protein, applied in the field of preparation of target protein
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Cloning of Huwen analgesic peptide gene.
[0058] 1. Design of oligonucleotide fragment of Huwen analgesic peptide gene
[0059] According to the preference of Pichia pastoris to codons, the gene encoding the mature peptide of Huwen analgesic peptide was optimized. Without changing the amino acid sequence, the codons used frequently by Pichia pastoris were used to replace rare codons. There are 4 Oligos, each of which has 15-16 bases complement each other. Oligo is synthesized by Invitrogen Biotechnology Co., Ltd.
[0060] Oligo1: AT GAATTC GCTTGTAAGGGTGTC (SEQ ID NO:1) where the single underlined line is the EcoR I restriction site, the double underlined line is the BglII restriction site, and the single underlined wavy line is the yeast kex2 restriction site.
[0061] Oligo2: GTTTGGACAACACTCGTTCTTACCTGGAGTACAAGCGTCGAAGACACCCTTACAAGC (SEQ ID NO: 2)
[0062] Oligo3: GAGTGTTGTCCAAACAGAGTTTGTTCTGACAAGCACAAGTGGT GTAAGTGGAAGTTG (SEQ ID NO: 3)
[0063] Oligo4: TAT GCGG...
Embodiment 2
[0071] Example 2: Eukaryotic expression and purification of the multi-copy directional cloning construct of Huwen analgesic peptide gene
[0072] 1. Yeast expression of multi-copy directional cloning construct of Huwen analgesic peptide gene
[0073] Plasmid PUC57-HWAP-I-PUC57-8HWAP-I containing the Huwen analgesic peptide 1-8 tandem gene was digested with EcoR I / NotI and the Huwen analgesic peptide 1-8 tandem gene was recovered, and the recovered fragment By T 4 The ligase was ligated to the pPIC9K vector (preserved in our laboratory) recovered after the double digestion with EcoR I / NotI, the ligation mixture was transformed into E. coli DH5α, and the transformed bacteria solution was spread on LB plates containing kanamycin Incubate at 37°C for 14-16h for culture screening. Perform PCR detection on the positive clones selected first, and see the results Figure 9-11 . among them Picture 9 Lane M is a DNA marker; Lane 1 is empty pPIC9K; Lanes 2-9 are PCR results of positive clo...
Embodiment 3
[0084] Example 3: Study on the activity of Huwen analgesic peptide monomer product
[0085] The biological activity of the recombinant Huwen analgesic peptide was detected by the thermal radiation-tail-flicking pain test of epidural medication in SD rats. Refer to Zhang Yong's method (Zhang Yong's doctoral dissertation, The role of acupuncture in the treatment of chronic neuropathic pain and its primary sensory nerve mechanism, 1999, April, Tongji Medical University). SD rats were purchased from the Animal Center of Xiamen University School of Medicine. The activity test results show that the recombinant Huwen analgesic peptide obtained in the above steps has a certain analgesic effect and a certain positive dose-effect relationship.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



