Mouse model capable of monitoring activity of IFN-beta (interferon-beta) or NF-kappa B (nuclear factor-kappa B) in liver via living imaging and construction method for same

A mouse model and liver technology, applied in the field of biology, can solve the problems of less research on regulatory mechanisms, difficulties, lack of real-time, dynamic modeling, and convenient use of animal models

Active Publication Date: 2013-06-26
FIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most of the current research on NF-κB is based on the cellular level, and the research on the regulation mechanism at the real animal level is relatively rare and difficult. The main reason is the lack of real-time, dynamic, easy-to-model, and convenient-to-use animal model

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mouse model capable of monitoring activity of IFN-beta (interferon-beta) or NF-kappa B (nuclear factor-kappa B) in liver via living imaging and construction method for same
  • Mouse model capable of monitoring activity of IFN-beta (interferon-beta) or NF-kappa B (nuclear factor-kappa B) in liver via living imaging and construction method for same
  • Mouse model capable of monitoring activity of IFN-beta (interferon-beta) or NF-kappa B (nuclear factor-kappa B) in liver via living imaging and construction method for same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1. Construction of a mouse model capable of live imaging monitoring of IFN-β activity in the liver

[0036] Using the method of the present invention to construct a mouse model capable of live imaging monitoring of IFN-β activity in the liver, the specific method includes the following steps:

[0037] 1. Construction of recombinant vector pGL3-attB-IFNβ carrying phage integrase recognition site attB gene, IFN-β promoter and firefly luciferase (Fluc) reporter gene

[0038] Using the HepG2 cell genome as a template, the upstream primer IFNBpf:

[0039] AGATCTAATTCTCAGGTCGTTTGCTT and downstream primer IFNBpr:

[0040] Guided by AAGCTTAAAGGTTGCAGTTAGAATGT, utilize high-fidelity PrimeSTARTM HSDNA polymerase, PCR amplifies the IFN-beta promoter sequence of people (its nucleotide sequence is as shown in sequence 1 in the sequence listing), after the amplification finishes, carry out 1% agarose gel electrophoresis to the PCR amplification product, Recover and purify ...

Embodiment 2

[0071] Example 2, Evaluation of the activation of the IFN-β promoter using a mouse model that can monitor IFN-β activity with live imaging

[0072] In order to verify whether the mouse model of live imaging monitoring IFN-β activity in the liver constructed in Example 1 can be used to evaluate the activation of IFN-β in the mouse liver, a pathogen-associated molecular pattern in the signaling pathway produced by IFN-β was selected. poly(I:C) as an inducer. Add poly(I:C) to normal saline equivalent to 10% of the mouse body weight, and quickly inject (5-8sec) into the mouse body by hydrodynamic transfection method, and detect the expression of mouse liver luciferase and serum The level of IFN-β in the blood, specifically: 10 μg of poly(I:C) was sent to the liver of 3 mice (experimental group), and the small mice were monitored by live imaging at 4, 8, 12, 24, 48, and 60 hours. Fluorescence activity of mouse liver, and three control mice were hydrodynamically injected with norma...

Embodiment 3

[0075] Example 3. Evaluation of IFN-β Promoter Inhibition Using a Mouse Model That Can Live Imaging Monitor IFN-β Activity in the Liver

[0076] HCV NS3 / 4A protease is a known inhibitor of the IFN-β activation signaling pathway. Studies at the cellular level have demonstrated that HCV NS3 / 4A protease can block the IFN-β activation signal by cleaving MAVS in human cells conduction. The mouse model for monitoring IFN-β activity by in vivo imaging constructed in Example 1 was used to evaluate the inhibitory effect of HCV NS3 / 4A protease on IFN-β. Two groups of plasmids, pCI-neo (control group, purchased from Promega) and pCI-HCVNS3 / 4A (experimental group, constructed by inserting HCVNS3 / 4A into the pCI-neo vector), were transfected into Example 1 using a hydrodynamic method. Intravital imaging to monitor IFN-β activity in the liver of a mouse model, stimulate IFN-β activation with poly(I:C) 10 μg (or saline) 24 hours later, and monitor luciferase activity by intravital fluoresce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mouse model capable of the monitoring activity of IFN-beta (interferon-beta) or NF-kappa B (nuclear factor-kappa B) in a liver via living imaging and a construction method for the same. According to the construction method disclosed by the invention, the mouse model integrating the firefly luciferase (Fluc) reporter gene which is regulated and expressed by IFN-beta promoter or NF-kappa B gene into the liver of a mouse is obtained by constructing a recombinant vector carrying bacteriophage integrase recognition site attB gene, the IFN-beta promoter or the NF-kappa B gene and the firefly luciferase (Fluc) reporter gene, and leading the recombinant vector into the body of the mouse by a hydrodynamic method. The mouse model disclosed by the invention can be used for evaluating the regulation effects of different factors on the activity of the IFN-beta promoter or the NF-kappa B in the body, can also be used as an evaluation model for interferon or inflammatory factor regulation medicines, molecules and viruses in innate immunity, and can be widely applied to the biomedical animal experiments of various categories.

Description

technical field [0001] The invention belongs to the animal model and its construction method in the field of biology, in particular to a mouse model capable of live imaging monitoring of IFN-β or NF-κB activity and its construction method. Background technique [0002] Type I interferon (Interferon, IFN) plays an important role in natural immune response, and its main members are IFN-α and IFN-β. The liver is an important place for protein synthesis and activation of many natural immune components. Many immune-related molecules can Activated by signals derived from hepatocytes, what effect the liver's innate immune system plays in hepatitis virus infection and its immunopathogenicity has become a hot topic of research by scholars. The study of IFN at the cellular level cannot reflect its real situation in the complex and complete immune system. At present, there is no suitable animal model to investigate the activity of IFN in the liver of living animals. [0003] Nuclear f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/63A01K67/027
Inventor詹林盛周勇阎少多贾帅争
OwnerFIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY