Gene segment with coded and highly-active trans-4-hydroxyl-L-prolyl hydroxylase and application thereof

A technology of proline hydroxylase and gene fragments, applied in application, genetic engineering, oxidoreductase, etc., can solve the problems of complex medium components, low conversion efficiency, difficult separation and purification, etc., and achieve good industrial application prospects , shorter conversion times, and higher conversion rates

Active Publication Date: 2013-09-04
HEBEI BOLUNTE PHARMA +1
View PDF4 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the expression vector they built is not a common vector, and the construction process is very cumbersome. The transformation process is to directly add the substrate to the culture medium of Escherichia coli engineering bacteria. There are certain flaws in the use of
In 2010, German scientists used pET-28a as a carrier and GroEL / GroES cofactors to improve the solubility of the enzyme, and the ability to convert L-proline to trans-4-hydroxy-L-proline was 61%. low efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene segment with coded and highly-active trans-4-hydroxyl-L-prolyl hydroxylase and application thereof
  • Gene segment with coded and highly-active trans-4-hydroxyl-L-prolyl hydroxylase and application thereof
  • Gene segment with coded and highly-active trans-4-hydroxyl-L-prolyl hydroxylase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Gene optimization of trans-4-hydroxyl-L-proline hydroxylase and construction of engineering strains

[0031] (1) Optimization of gene codons

[0032] The gene after codon optimization is attached Figure 1 Shown in SEQ ID No.1, named as p4hyd .

[0033] (2) Truncation of gene length

[0034] Design gene truncated primers as follows:

[0035] 5'-3' (SEQ ID No.4 and SEQ ID No.5)

[0036] Upstream primer: 5′GT GAATTC ATGCTGACCCCGACCGAACTG3′ (the underlined italic part is the EcoR I restriction site)

[0037] Downstream primer: 5′CT CTCGAG CTAGGTGGCGTCACGAGCAGC3′ (the underlined italic part is the Xho I restriction site)

[0038] The truncated gene was amplified by polymerase chain reaction (PCR), cloned and constructed into the expression vector pET-M-3C, and verified by sequencing. The obtained gene sequence is shown in SEQ ID No.2, and the corresponding amino acid sequence is shown in SEQ ID No.3.

[0039] The PCR reaction system is as follows: ...

Embodiment 2

[0057] Example 2 Expression and Biotransformation Efficiency Detection of Recombinant Plasmids in Engineering Bacteria

[0058] Activate the single clones of the engineering strains containing the two recombinant plasmids respectively, in LB medium, activate and culture for 3-4 generations at 28°C, and cultivate to OD 600 0.5-0.8, add 0.1-0.4mM IPTG, and induce protein expression at 25-30°C for 4-10h. Collect the bacteria by centrifugation, discard the supernatant, resuspend each 1g of bacteria in 10mL-15mL transformation system containing substrate (200mM L-proline, 200mM α-ketoglutaric acid, 6mM ferrous sulfate, 6mM L-ascorbic acid , 80mM MES pH 6.5 and 1% Nonidet P-40), shake the reaction at 28°C for 40-80 hours, centrifuge to remove the bacteria, and detect the conversion of L-proline in the supernatant to trans-4-hydroxy-L by HPLC -The conversion rate of proline, as shown in table 1. Under the same conditions, P4Hyd and P4Hyd 1-257 The highest conversion rates were 91....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
conversion efficiencyaaaaaaaaaa
Login to View More

Abstract

The invention discloses a gene segment provided with coded and highly-active trans-4-hydroxyl-L-prolyl hydroxylase and an application thereof. Gene codons of trans-4-hydroxyl-L-prolyl hydroxylase (GenBank ID: BAA 20094.1) in Dactylosporangiumsp. RH1 are optimized to obtain a p4hyd gene; the optimized p4hyd gene is truncated to obtain a P4Hyd1-257 gene; recombinant plasmids including pET-M-3C-P4Hyd and pET-M-3C-P4Hyd1-257 are built respectively, prokaryotic expression is performed through escherichia coli, and trans-4-hydroxyl-L-proline is produced in a conversion manner by utilizing thalli as an enzyme source. An experimental result shows that L-proline is taken as a substrate, compared with pET-M-3C-P4Hyd, the highest conversion rate of trans-4-hydroxyl-L-proline generated by pET-M-3C-P4Hyd1-257 in the conversion manner is increased from 91.4% to 97.4%, the conversion time is shortened from 80 hours to 60 hours, so that the conversion rate is improved remarkably, and the conversion time is shortened remarkably. The gene segment provided with coded and highly-active trans-4-hydroxyl-L-prolyl hydroxylase and the application thereof can be used for producing L-proline by a bioconversion method, and have better industrial application prospect.

Description

technical field [0001] The invention relates to a gene segment encoding highly active trans-4-hydroxyl-L-proline hydroxylase and its application, belonging to the fields of genetic engineering, enzyme engineering and biomedicine. Background technique [0002] Hydroxyproline (Hyp) is not one of the 20 common amino acids. It is the result of hydroxylation modification of proline. The hydroxyl group is usually added to the 4th or 3rd carbon. Due to two asymmetric carbon atoms, hydroxyproline has 4 stereoisomers. trans-4-hydroxy-L-proline, cis-4-hydroxy-L-proline, trans-3-hydroxy-L-proline and cis-3-hydroxy-L-proline acid. [0003] Trans-4-hydroxy-L-proline mainly exists in collagen in mammalian cells, and plays a very important role in the formation of stable triple-helix collagen, which can strengthen the elasticity and toughness of connective tissue (Shibasaki , T. Mori, H. ozaki, A. 2000). Imbalance of hydroxyproline in body fluids can cause many diseases such as malnutr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/70C12P13/24C12R1/19
Inventor李玮张金秀王立安李天云陈娇娇鞠建松薛张伟张琳琳张庆
OwnerHEBEI BOLUNTE PHARMA