Construction of factor C from tachypleus tridentatus pronucleus and insect baculovirus recombinant expression vector
A factor and carrier technology, applied in the field of genetic engineering, can solve problems such as false positives, differences in physical and chemical properties, and reduction in the number of sea horseshoe crabs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] 1. The Chinese horseshoe crab factor C (FC) gene constructed on the prokaryotic expression vector and the baculovirus expression vector has the base sequence of the sequence table SEQIDNo.1:
[0062] ATGGTCTTAGCGTCGTTTTTGGTGTCTGGTTTAGTTCTTAGGGCTACTAGCCCAACAAATG60
[0063] CGTCCAGTTCAGTCCAGAGGAGTAGATCTGGGCTTGTGTGATGAAACGAGGTTCGAGTGT120
[0064] AAGTGTGGAGATCCAGGCTATGTGTTCAACGTCCCTATGAAACAATGCACGTACTTCTAT180
[0065] CGATGGAGGCCTTATTGTAAACCATGTGATGACCTGGAGGCTAAGGACATTTGTCCAAAG240
[0066] TACAAACGATGTCAAGAGTGTAAGGCTGGTCTTGATAGTTGTGTTACTTGTCCACCTAAC300
[0067] AAATATGGTACTTGGTGTAGCGGTGAATGTCAATGTAAGAATGGAGGTATCTGTGACCAG360
[0068] AGGACAGGAGCTTGTGCGTGTCGTGACAGATATGAAGGAGCGCACTGTGAAATTCTCAAA420
[0069] GGTTGTCCTTCTTCTTCCATCGGATTTCTCAAGTTCAGGAAGTCAGAAACCCACCAGATAAT480
[0070] CCCCAAACTATTGACTACAGCTGTTCACCAGGGTTCAAGCTTAAAGGCGTGGCACGAATT540
[0071] AGCTGTCTCCCAAATGGACAGTGGAGTAGCTTTTCCACCCAAATGTATTCGAGAATGTGCC600
[0072] AAGGTTTCATTCTCCAGAACACGGGAAAGTGAATGCTCCTAGTG...
Embodiment 2
[0131] The plasmid construction of the prokaryotic expression vector of implementation example 2 Chinese horseshoe crab C factor:
[0132] a) Double enzyme digestion and recovery of Chinese horseshoe crab factor C DNA and pET28a vector plasmid: each take 1 μg of the pET28a plasmid and the PCR recovery product of Chinese horseshoe crab factor C described in Example 1 and carry out in a reaction system containing endonucleases NcoI and NotI Double digestion, digestion at 37°C for 1 hour;
[0133] The reaction system is 30μl, 10×buffer3μl, NcoI and NotI are 10U respectively, and the remaining volume is made up with sterile water, and the endonuclease is from Fermentas company; the PCR product is double-digested and inactivated at 65°C for 15min, and then the PCR fragment is used The recovery kit was recovered for future use (see the instructions of the PCR recovery kit of Sangon Company); the pET28a vector was double-enzymatically digested and subjected to 1% agarose gel electrop...
Embodiment 3
[0143] The plasmid construction of implementation example 3 Chinese horseshoe crab C factor baculovirus expression vector:
[0144] a) Double enzyme digestion and recovery of Chinese horseshoe crab factor C DNA and pFASTBacHTA vector plasmid: each take 1 μg of pFASTBacHTA plasmid and the PCR recovery product of Chinese horseshoe crab factor C described in Example 1, respectively in the reaction system containing endonuclease NcoI and NotI Carry out double enzyme digestion at 37°C for 1 hour.
[0145] The reaction system is 30μl, NcoI and NotI are 10U, 10×buffer 3μl, and the remaining volume is filled with sterile water, and the endonuclease is from Fermentas company; the PCR product is double-digested and inactivated at 65°C for 15min, and then the PCR fragment is used The recovery kit was recovered for future use (see the instructions of the PCR recovery kit of Sangon Company); the pET28a vector was double-enzymatically digested and subjected to 1% agarose gel electrophoresis...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com