Supercharge Your Innovation With Domain-Expert AI Agents!

Construction of factor C from tachypleus tridentatus pronucleus and insect baculovirus recombinant expression vector

A factor and carrier technology, applied in the field of genetic engineering, can solve problems such as false positives, differences in physical and chemical properties, and reduction in the number of sea horseshoe crabs

Inactive Publication Date: 2013-09-11
SHANGHAI BAISHENG BIOTECH CO LTD
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are only two kinds of LAL (Limulus amoebocytelysate) and TAL (Tachypleus Amebocyte Lysate) that can be used in the production of LAL (Limulus amebocyte Lysate) respectively. The two have the same reaction principle and efficacy, but there are also differences in physical and chemical properties. Differences, such as the optimum pH for reacting with endotoxin, etc. (6)
[0006]Although the limulus assay (LAL / TAL) has the advantages of high sensitivity (can detect femtogram-level endotoxin) and rapidity, due to the use of complex cell lysis As a reaction raw material, it also has insurmountable defects
For example, the problem of non-specific interference: In addition to reacting with endotoxin, Limulus reagent also reacts with (1-3)-β-D-glucan (1)
Therefore, it is easy to encounter non-specific interference of (1-3)-β-D-glucan in the detection process of Limulus reagent, resulting in false positive results. This is a big test for drugs with complex components, especially traditional Chinese medicine. challenge(7)
Another example is the issue of batch stability: Limulus reagent uses Limulus blood as the raw material for production. Due to differences in seasons and regions, batch differences in Limulus reagent become a common phenomenon.
Moreover, due to environmental pollution, overfishing and other reasons, the population of horseshoe crabs has decreased sharply in recent years and is close to extinction (8), which makes the raw materials for the production of Limulus reagents face the danger of increasing scarcity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of factor C from tachypleus tridentatus pronucleus and insect baculovirus recombinant expression vector
  • Construction of factor C from tachypleus tridentatus pronucleus and insect baculovirus recombinant expression vector
  • Construction of factor C from tachypleus tridentatus pronucleus and insect baculovirus recombinant expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] 1. The Chinese horseshoe crab factor C (FC) gene constructed on the prokaryotic expression vector and the baculovirus expression vector has the base sequence of the sequence table SEQIDNo.1:

[0062] ATGGTCTTAGCGTCGTTTTTGGTGTCTGGTTTAGTTCTTAGGGCTACTAGCCCAACAAATG60

[0063] CGTCCAGTTCAGTCCAGAGGAGTAGATCTGGGCTTGTGTGATGAAACGAGGTTCGAGTGT120

[0064] AAGTGTGGAGATCCAGGCTATGTGTTCAACGTCCCTATGAAACAATGCACGTACTTCTAT180

[0065] CGATGGAGGCCTTATTGTAAACCATGTGATGACCTGGAGGCTAAGGACATTTGTCCAAAG240

[0066] TACAAACGATGTCAAGAGTGTAAGGCTGGTCTTGATAGTTGTGTTACTTGTCCACCTAAC300

[0067] AAATATGGTACTTGGTGTAGCGGTGAATGTCAATGTAAGAATGGAGGTATCTGTGACCAG360

[0068] AGGACAGGAGCTTGTGCGTGTCGTGACAGATATGAAGGAGCGCACTGTGAAATTCTCAAA420

[0069] GGTTGTCCTTCTTCTTCCATCGGATTTCTCAAGTTCAGGAAGTCAGAAACCCACCAGATAAT480

[0070] CCCCAAACTATTGACTACAGCTGTTCACCAGGGTTCAAGCTTAAAGGCGTGGCACGAATT540

[0071] AGCTGTCTCCCAAATGGACAGTGGAGTAGCTTTTCCACCCAAATGTATTCGAGAATGTGCC600

[0072] AAGGTTTCATTCTCCAGAACACGGGAAAGTGAATGCTCCTAGTG...

Embodiment 2

[0131] The plasmid construction of the prokaryotic expression vector of implementation example 2 Chinese horseshoe crab C factor:

[0132] a) Double enzyme digestion and recovery of Chinese horseshoe crab factor C DNA and pET28a vector plasmid: each take 1 μg of the pET28a plasmid and the PCR recovery product of Chinese horseshoe crab factor C described in Example 1 and carry out in a reaction system containing endonucleases NcoI and NotI Double digestion, digestion at 37°C for 1 hour;

[0133] The reaction system is 30μl, 10×buffer3μl, NcoI and NotI are 10U respectively, and the remaining volume is made up with sterile water, and the endonuclease is from Fermentas company; the PCR product is double-digested and inactivated at 65°C for 15min, and then the PCR fragment is used The recovery kit was recovered for future use (see the instructions of the PCR recovery kit of Sangon Company); the pET28a vector was double-enzymatically digested and subjected to 1% agarose gel electrop...

Embodiment 3

[0143] The plasmid construction of implementation example 3 Chinese horseshoe crab C factor baculovirus expression vector:

[0144] a) Double enzyme digestion and recovery of Chinese horseshoe crab factor C DNA and pFASTBacHTA vector plasmid: each take 1 μg of pFASTBacHTA plasmid and the PCR recovery product of Chinese horseshoe crab factor C described in Example 1, respectively in the reaction system containing endonuclease NcoI and NotI Carry out double enzyme digestion at 37°C for 1 hour.

[0145] The reaction system is 30μl, NcoI and NotI are 10U, 10×buffer 3μl, and the remaining volume is filled with sterile water, and the endonuclease is from Fermentas company; the PCR product is double-digested and inactivated at 65°C for 15min, and then the PCR fragment is used The recovery kit was recovered for future use (see the instructions of the PCR recovery kit of Sangon Company); the pET28a vector was double-enzymatically digested and subjected to 1% agarose gel electrophoresis...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnology, in particular to construction of a gene prokaryotic cell and insect cell expression plasmid of a factor C from tachypleus tridentatus. The gene sequence of the factor C from tachypleus tridentatus is shown by SEQ ID No.1 and consists of 3057bp; and the two ends of a primer for cloning respectively contain an NcoI enzyme digestion site and an NotI enzyme digestion site. The gene of the factor C from tachypleus tridentatus is cloned into a prokaryotic expression vector pET28a and a baculovirus expression vector pFASTBacHTA, and the DNA (deoxyribonucleic acid) sequencing proves that the sequence cloning is correct. The method successfully constructs a prokaryotic recombinant expression plasmid pET28a-FC and a baculovirus recombinant expression plasmid pFASTBacHTA-FC of the factor C from tachypleus tridentatus. The invention provides a new method for the heterogeneous expression of the factor C from tachypleus tridentatus, and also lays a foundation for the follow-up research and application of a large amount of expression of the factor C from tachypleus tridentatus in prokaryotic cells and insect cells.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the plasmid construction of the Chinese horseshoe crab factor C gene expression vector in prokaryotic cells and insect cells. Background technique [0002] Among clinical infusion reactions, pyrogen reaction is the most harmful and has the highest incidence rate. Endotoxin (lipopolysaccharide, LPS) is the most well-studied and most common biological pyrogen, and it is also a problem that major pharmaceutical companies must face, because even pg Trace levels of LPS can also cause severe pyrogen reactions in patients. Therefore, a sensitive and reliable endotoxin diagnostic technique is very necessary. [0003] The amoeba-like cells (amoebocytes) of sea crab have super sensitivity to LPS. When Gram-negative bacteria invade, it can produce a cascade agglutination reaction to the foreign invading bacteria through a series of enzymatic reactions, so that Invading microorganisms a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/57C12N15/10C12N15/70C12N15/74C12N15/866C12N15/66
Inventor 牟宗春高雪超郭恒昌庄家麟周康
Owner SHANGHAI BAISHENG BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More