A nanobody fusion protein and its preparation method and application

A fusion protein and nanobody technology, applied in the direction of antibodies, chemical instruments and methods, hybrid peptides, etc., can solve the problem of expensive TNFa antagonists, achieve high stability and antigen binding activity, easy to scale up production, and avoid side effects Effect

Inactive Publication Date: 2015-09-16
NANJING RUIBIDE BIOTECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition to safety concerns, most TNFa antagonists are expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A nanobody fusion protein and its preparation method and application
  • A nanobody fusion protein and its preparation method and application
  • A nanobody fusion protein and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Acquisition of fusion gene anti-TNF-VHH-Fc

[0034] 1. PCR reaction to obtain anti-TNF-VHH gene:

[0035] Set up the following reaction system in a 25μl PCR reaction tube:

[0036]

[0037] The reaction conditions are as follows:

[0038]

[0039] anti-TNF-VHH-F is the upstream primer of anti-TNF-VHH gene, its nucleotide sequence is: CCGGCTCGAGAAAAGAGAGGCTCAGGTGCAGCTGGTGGAGT

[0040] anti-TNF-VHH-R is the downstream primer of anti-TNF-VHH gene, nucleotide sequence TTTGTCACAAGATTTGGGCTCAGAGGAGACGGTGACTTG

[0041] 2. PCR reaction to obtain Fc gene:

[0042] The reaction system is as follows:

[0043]

[0044] The reaction conditions are as follows:

[0045]

[0046] Fc-F is the upstream primer of the Fc gene, its nucleotide sequence is CAAGTCACCGTCTCCTCTGAGCCCAAATCTTGTGACAAA;

[0047] Fc-R is the downstream primer of the Fc gene, and its nucleotide sequence is GCCTCTAGATCATTTACCCGGAGACAGGGA.

[0048] 3. Connect anti-TNF-VHH and human IgG1 Fc gene, and p...

Embodiment 2

[0056] Construction of pPICZa-anti-TNF-VHH-Fc / GS115 eukaryotic expression strain

[0057] 1. After the PCR product is separated by electrophoresis, cut the gel to recover the target fragment, and establish the following enzyme digestion reaction system with the carrier:

[0058]

[0059] React at 37°C for 4h.

[0060] 2. Without purifying the digested mixture, directly phosphorylate the target gene and dephosphorylate the carrier, the steps are as follows.

[0061] Phosphorylation system (Takara reagent):

[0062]

[0063] Dephosphorylation system (Takara reagent):

[0064]

[0065] Then establish the following connection reaction system:

[0066]

[0067] Reaction at 16°C for 12h.

[0068] After double digestion, the anti-TNF-VHH-Fc gene was connected to the yeast expression vector pPICZaA vector, and the successfully constructed yeast expression vector pPICZaA-anti-TNF-VHH-Fc was obtained. The vector construction diagram is shown in figure 2 .

Embodiment 3

[0070] Construction of pPICZa-anti-TNF-VHH-Fc / GS115 eukaryotic expression strain

[0071] 1. Linearization of plasmids:

[0072] The sequenced correct recombinant plasmid pPICZaA-anti-TNF-VHH-Fc / control plasmid pPICZaA was digested with Sac?.

[0073] The reaction system is as follows:

[0074]

[0075] 10 parallel experimental systems, a total of 200uL, reaction conditions: 37°C, 5h

[0076] 2. Purification, concentration and identification of linearized plasmids:

[0077] Combine the enzyme digestion reaction solution of the plasmid into a sterilized 1.5mL EP tube, add 3 times the volume of absolute ethanol, and mix with 1 / 3 volume of 3M NaAc; stand at -70°C for 30min to precipitate DNA; 4°C , Centrifuge at 12000rpm for 30min, discard the supernatant, place at room temperature, wait for ethanol to volatilize, add 10uL sterilized double distilled water to dissolve, and store at -20℃ for later use.

[0078] 3. Transformation of yeast:

[0079] (1) Preparation of yeast ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nano antibody fusion protein which is formed by connecting an Fc segment of a human immunoglobulin G with a VHH antibody segment of camel anti-human TNFa. The invention also discloses a preparation method and application of the fusion protein. Compared with the prokaryotically-expressed TNFa nano antibody and the prokaryotically-expressed Fc-modified TNFa nano antibody, the nano antibody fusion protein disclosed by the invention has higher biological activity; the yeast expression anti-TNF-VHH-Fc protein forms a complete dimer form, and thus, has higher stability and antigen combination activity; the Fc segment of immunoglobulin is selected as a fusion segment, thereby avoiding the generation of side effect; and the invention has the advantages of high expression level and low cost, and can easily implement scale-up production.

Description

technical field [0001] The invention relates to the expression and preparation of human immunoglobulin crystallizable fragment (crystalizable fragment, Fc) fusion camel anti-human TNFa nanobody. The fusion nanobody protein anti-TNF-VHH-Fc prepared by this method has higher antigen binding ability and can be used for the treatment of human related diseases. Background technique [0002] Members of the TNF superfamily play important roles in the pathogenesis of various human diseases. Thus, this superfamily represents an active target for drug development. Various antibody drugs targeting TNF family members and their receptors have been approved by the FDA, and some are undergoing clinical trials. These agents are effective in preventing rheumatoid arthritis, psoriatic arthritis, psoriasis, ulcerative colitis and Crohn's disease. TNFa is tumor necrosis factor, and there are two approved treatments for TNFa: one is a soluble receptor that binds to circulating TNFa to prevent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/81G01N33/68A61K39/395A61K47/48A61P37/02A61K47/64
Inventor曹鹏张双全夏志南乔波
OwnerNANJING RUIBIDE BIOTECH