Vegetable oil skin care lotion containing basic fibroblast growth factor active peptide
A technology of growth factor activity and fibroblasts, which is applied in the fields of biotechnology and cosmetics, can solve the problems of low survival rate and increased survival rate of nerve cells, and achieve the effects of simple process, reduced cost and reduced production cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Synthesis of Basic Fibroblast Growth Factor Gene
[0036] According to the preference of plant codons, the nucleotide sequence of basic fibroblast growth factor bFGF found in GENBANK was modified, and the rare amino acid codons with less content in plants were replaced with plant-preferred codons. According to the degeneracy of codons, the enzyme cutting sites used in this experiment were eliminated, and then sent to Shanghai Sangon Bioengineering Co., Ltd. for artificial synthesis of recombinant basic fibroblast growth factor gene (SEQ ID NO.1).
Embodiment 2
[0037] Example 2: Cloning of kidney bean seed-specific promoter and terminator
[0038] To clone the promoter and terminator genes of kidney bean, in order to clone the seed-specific promoter and terminator from the genome sequence of kidney bean, using primers, the standard polymerase chain reaction (PCR) was used to amplify the 1548bp and 1220bp genes from the genome of kidney bean DNA fragments, the amplified fragments were digested with restriction endonucleases, cloned into the pUC57 cloning vector, and stored for future use. After sequencing, its base sequence is shown in the sequence table SEQ ID NO.2 and SEQ ID NO.3.
[0039] bean promoter primer
[0040] Primer5F: GAATTCATTGTACTCCCAG
[0041] Primer5R: AGTAGAGTAGTATTGAATATGAG
[0042] bean terminator primer
[0043] tem5F: AATAAGTATGAACTAAAATGC
[0044] tem5R: TTAGTTGGTAGGGTGCTAGGAA
Embodiment 3
[0045] Example 3: Construction of plant-specific expression vector pOBT
[0046] The cloning vector of pUC57-bean promoter was digested with restriction endonucleases pstI and NcoI, and the target fragment of the bean promoter sequence was recovered. At the same time, the basic plasmid pO was digested with pstI and NcoI (taking p1301 as the basic skeleton, and its T-DNA region Transformation was carried out, except for the NOS gene that retained the T-DNA region, the rest of the genes were replaced by 35S and Bar genes, using the pEGAD plasmid as a template, using the 35S-F upstream primer 47bp cggggtaccAtccgtcaacatggtggagcacgacacgcttgtctact and the Bar-R downstream primer 54bp cggaattcactagttcagatctcggtgacgggcaggaccggacggggcggaacc for PCR amplification. The 35S-Bar gene was amplified, and inserted into the front of the NOS gene in the T-DNA region of the pCAMBIA1301 vector using the kpnI and SpeI restriction sites to construct the p1301-35S-Bar-NOS basic plasmid (abbreviated...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com