Unlock instant, AI-driven research and patent intelligence for your innovation.

Sea anemone Kunitz-type protease inhibitor and application thereof

A protease inhibitor, trypsin inhibition technology, applied in the direction of protease inhibitors, applications, peptide/protein components, etc., can solve problems such as limited research

Inactive Publication Date: 2015-04-15
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, there is limited research on Kunitz-type protease inhibitors and their functions in sea anemones

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sea anemone Kunitz-type protease inhibitor and application thereof
  • Sea anemone Kunitz-type protease inhibitor and application thereof
  • Sea anemone Kunitz-type protease inhibitor and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1: Separation and purification of sea anemone protease inhibitor SGPI-1

[0024] Take 5g of the tentacle tissue of the giant row finger sea anemone, cut it into pieces, add 20ml of cold deionized water to homogenate, and centrifuge at 15000rpm for 20 minutes to remove the residue. Filtrate through a 0.45 μm filter to obtain the crude poison of sea anemone toxin and store it at -75°C. Take 1ml of the crude poisonous sample and put it on the Hitrap Capto S cation exchange column, which is pre-balanced with 0.05mol / L ammonium acetate buffer solution (pH5.5). After sample loading, use 10%, 30% and 100% 1mol / L sodium chloride buffer solution (containing 0.05mol / L ammonium acetate, pH5.5) for gradient elution, each gradient elution time is 5min, and the flow rate is 1ml / min. 100% of the eluted fractions were pooled and lyophilized. The lyophilized sample was reconstituted with 0.15mol / L ammonium acetate buffer (pH5.5), and 2ml was passed through a HiLoad16 / 60Sup...

Embodiment 2

[0025] Example 2: Total RNA Extraction and cDNA Synthesis of Tentacles of Carpet Sea Anemone

[0026] RNase-free utensils were prepared, and the extraction of total RNA from tentacles of the carpet sea anemone was performed according to the instructions of RNAiso Plus from TaKaRa Company; the cDNA synthesis was operated according to the instructions of Fermentas RevertAid First Strand cDNA Synthesis Kit. Two bands of 18S and 28S can be seen in the extracted total RNA by electrophoresis, indicating that the integrity of the total RNA is good.

Embodiment 3

[0027] Embodiment 3: Cloning, sequence determination and analysis of SGPI-1 gene

[0028] According to the results of sequencing with the N-terminal of SGPI-1, degenerate primers were designed, and the primer sequences were as follows:

[0029] TGCTCTGAACCAAARGTNGTTGG (SEQ ID NO: 3).

[0030] Using the cDNA obtained in Example 2 as a template, the 3'-RACE kit (TaKaRa) was used to clone the SGPI-1 gene. Agarose electrophoresis detection, there is a specific amplification band around 200bp. This band was recovered and sent to Shanghai Yingjun Biotechnology Co., Ltd. (Invitrogen) for nucleic acid sequence determination. The obtained sequence was subjected to blast homology analysis. New toxin protein.

[0031] The DNA sequence is as follows:

[0032] TCTGGAATTTGCTCTGAACCAAAAGTTGTTGGCCGGTGTCGAGGAAGTTTTTCCAAGATTCTACTTCGATTCAGAGACGGGAGAGTGCAAACCCTTCATCTACGGTGGATGCGGGGGAAATGGGAATAACTTTGAGACCCTGCATCAATGCCGAGCTATATGCAGGGCG TAA (SEQ ID NO:1, the underlined part is not translated) ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of marine biology. The sea anemone contains a lot of polypeptide toxins and proteins, such as toxin compounds and protease inhibitors, and especially, palytoxin in the nematocysts of the sea anemone, is believed to be a chemical weapon for defense. Currently, the studies on a sea anemone Kunitz-type protease inhibitor and the functions thereof are very limited. The present invention provides a sea anemone derived Kunitz-type protease inhibitor, the amino acid sequence of the protease inhibitor is shown in SEQ ID NO: 2. The present invention also provides the encoding gene of the protease inhibitor, and applications of the protease inhibitor in the preparation of drugs for the treatment of acute pancreatitis and acute hemorrhagic pharmaceutical, and pesticides.

Description

technical field [0001] The invention relates to the technical field of marine organisms, in particular to a sea anemone protease inhibitor, its coding gene and its application. Background technique [0002] At present, hundreds of serine protease inhibitors have been discovered, which are divided into more than a dozen families. The serine protease inhibitors in animals are mainly distributed in four families: Kunitz, Kazal, Serpin and α-macroglobulin. Among them, the Kunitz-type protease inhibitors contain one or more Kunitz domains encoded by about 60 amino acid residues, and this structure is its main functional region, which mainly inhibits trypsin and chymotrypsin. The sources of Kunitz-type protease inhibitors are very extensive, and now they have been obtained from bovine pancreas, porcine pancreas, human urine, snakes, trichosanthes, calla lily, sophora, peanuts, erythrina, Taihu cyanobacteria, tartary buckwheat, red bean, soybean, sea anemone Kunitz-type serine pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/81C12N15/15A61K38/57A61P1/18A61P7/04A01N47/44A01P7/04
Inventor 胡波张艺馨马蓓刘小宇卢小玲王梁华焦炳华郑欣闫凝星钱梦星
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY