Method for improving activity of pseudomonas aeruginosa elastase (PAE) by carrying out single-point mutation to delete salt bond in structure
A technology of site-directed mutagenesis and salt bond, applied in the field of genetic engineering method to improve enzyme activity, can solve problems such as in-depth analysis of salt bond effect, and achieve the effect of improving activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment １
[0056] (a) Mutant primer design:
[0057] Primer design was completed using Primer Premier 5.0 software. Primers were synthesized at Huada Genetics (BGI).
[0058] Primers at both ends:
[0059] Forward primer: GCTTGGAC CATATG AAGAAGGTTTCTACGCTTGACC, the dashed part indicates the Nde I restriction site.
[0060] Reverse primer: CGCG CTCGAG TTACAACGCGCTCGGGCAG, the underlined part indicates the Xho I restriction site.
[0061] D201A intermediate primer:
[0062] 3’ Primer: GCGCTGCGCTACATGGCGCAGCCCAGCCGCGAC
[0063] 5’ Primer: GCGGCTGGGCTGCGCCATGTAGCGCAGCGCACCG
[0064] R205A intermediate primer:
[0065] 3’ Primer: GACCAGCCCAGCGCGGACGGGCGATCCATC
[0066] 5' end primer: GGATCGCCCGTCCGCGCTGGGCTGGTCCATG.
[0067] Example 2
[0068] The prokaryotic expression of the above mutants is:
Embodiment 2
[0070] ① Use the forward primer containing the Nde I restriction site and the 3' primer of the intermediate primer of the mutant as the primers at both ends, and lasB The plasmid was used as a template, and the amplified product was marked as Ⅰ; the reverse primer containing the Xho I restriction site and the 5' primer of the intermediate primer of the mutant were used as primers at both ends, and lasB The plasmid was used as a template, and the amplified product was marked as II;
[0071] ② Recover Ⅰ and Ⅱ through PCR reaction procedure: 98 o C denatured 30 sec; 98 o C denatured 10 sec; 60 o C Annealing 30 sec; 72 o C extension 1 min, 7 cycles, 72 o Incubate at C for 7 minutes to fuse the genes Ⅰ and Ⅱ;
[0072] ③ Finally, add the forward and reverse primers on both sides and go through the PCR reaction program: 98oC denaturation for 30 sec; 98oC denaturation for 10 sec, 60oC annealing for 30 sec, 72oC extension for 1 min, 30 cycles; 98oC denaturation for 10 sec; 72oC ex...
Embodiment 3
[0076] ②Digest the DNA with restriction endonucleases NdeI and XhoI, and connect the pET-22b expression vector that has been digested with the same enzymes;
[0077] ③Connection product conversion E. coli DH5α, The transformation method refers to "Molecular Cloning Experiment Guide" (Third Edition) (Volume 1) (Sambrook et al., 2002);
[0078] ④Pick the transformants from the transformation plate and culture them in liquid LB medium, and select the transformants carrying the target gene by the method of plasmid extraction and verification;
[0079] ⑤Transform the sequenced correct plasmid containing the target gene E. coli BL21(DE3) ;
[0080] ⑥Pick a single colony of the transformant from the plate into a 5 ml liquid LB test tube, culture overnight at 37??C, transfer it to a fresh 30 ml liquid LB Erlenmeyer flask with 1% inoculum, and culture at 37??C until OD 600 =1.0 Add IPTG with a final concentration of 1 mM and continue culturing overnight;
[0081] ⑦ Collect the b...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More