Primer for detecting IDH1 and IDH2 gene polymorphism mutation sites, method and kit
A technology of kits and sequencing primers, applied in the fields of life science and biology, can solve the problems of high detection cost and cumbersome process, and achieve the effect of accurately diagnosing patient prognosis, improving the degree of automation, and eliminating cumbersome processes and a large amount of testing costs.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] The present invention will be further described below with reference to specific embodiments and accompanying drawings. It should be noted that the conventional conditions and methods that are not described in the examples are usually adopted by the experimenters in the field: Or follow the steps and conditions recommended by the manufacturer.
[0076]
[0077] A primer for detecting IDH1, IDH2 gene polymorphic mutation sites, the primer design is specific amplification primers designed for IDH1 and IDH2 mutation hot spots, including:
[0078] (i) Amplify primers containing the 132nd amino acid sequence of IDH1 gene, and its base sequence is:
[0079] IDH1-132-F: GATGAGAAGAGGGTTGAGGA
[0080] IDH1-132-R: GTTGGAAATTTCTGGGCCAT
[0081] (ii) Amplify primers containing the 140th and 172nd amino acid sequences of the IDH2 gene, the base sequences of which are:
[0082] IDH2-140 / 172-F: CTGTGTTGTTGCTTGGGGTT
[0083] IDH2-140 / 172-R: CAAGAGGATGGCTAGGCGAG
[0084] A ...
Embodiment 2
[0095] The operating process of the blood / cell / tissue genomic DNA extraction kit (Tiangen Bio):
[0096] (1) Extract tissue DNA from blood: 1) Add 500uL of blood to 1000uL of erythrocyte lysate, invert and mix, and leave at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, aspirate the supernatant, leave the leukocyte pellet, add 200uL of buffer GA, and shake until thoroughly mixed. 2) Add 20 μl proteinase K solution and mix well. 3) Add 200 μl of buffer GB, invert and mix well, place at 70°C for 10 minutes, the solution should become clear, and centrifuge briefly to remove water beads on the inner wall of the tube cover. 4) Add 200 μl of absolute ethanol, and mix thoroughly for 15 seconds. At this time, flocculent precipitation may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap. 5) Add the solution and flocculent precipitate obtained in the previous step to an adsorption co...
Embodiment 3
[0120] The nucleic acid detection reagent and method of the present invention are used to detect clinical specimens.
[0121] Twenty anticoagulant specimens from patients with acute myeloid leukemia (AML) were taken for inspection, and genomic DNA was extracted, reagents were prepared and detected according to the method described in Example 2.
[0122] Add 2 μl of each sample to the PCR reaction solution of the detection system. Do positive, negative and blank controls at the same time. A 96-well ordinary PCR machine can detect 46 samples at the same time, each sample is repeated twice, one positive control, one negative control and one blank control. The detection time is 160 minutes.
[0123] After each sample is sequenced twice, the mutations are compared, and the third sequence will be performed for samples with inconsistent results. Finally, the prognosis is judged according to the sequencing results. The test results are as follows:
[0124]
[0125] As can be se...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



