Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Porcine Sapelovirus real-time fluorescent quantitative RT-PCR detection method

A real-time fluorescence quantitative and detection method technology, applied in the biological field, can solve problems such as inability to detect, time-consuming, and delay in disease control

Inactive Publication Date: 2014-01-22
SHANGHAI JIAO TONG UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Virus isolation and enzyme-linked immunosorbent assay are the most basic detection methods, but they are also the most time-consuming detection methods. For the early diagnosis of sudden epidemic diseases, early detection cannot be achieved, which may delay the progress of the epidemic. control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine Sapelovirus real-time fluorescent quantitative RT-PCR detection method
  • Porcine Sapelovirus real-time fluorescent quantitative RT-PCR detection method
  • Porcine Sapelovirus real-time fluorescent quantitative RT-PCR detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] The making of embodiment 1 standard curve

[0051] 1) Primer design for the construction of amplified fragment standards

[0052] Design and construct primers on the target gene, and add a T7 promoter to the 5' end of the constructed upstream primer, and add 25 Ts to the 3' end of the constructed downstream primer, so that the constructed target gene standard RNA has Poly(A )tail. The T7 promoter sequence is as follows: ACTAATACGACTCACTATAGGG

[0053] The positional relationship of the specific primer design is shown in the following sequence (the spaced part is the construction primer region, the underlined part is the fluorescent quantitative RT-PCR primer region, the wavy part is the T7 promoter and the Poly(A) tail, and the arrow indicates the transcription start position ).

[0054] TCCCTTCCAAAGC GGATGGACACAAGGACTTGGACTCACGGCAAGTGCACATGGTATGATTTTGGATACACCTTAACGGCAGTAGCGTGGCGAGCTATGGAAAAATCGCAATTGTCGATAGCCATGTTAGTGACGCGCTTCGGCGTGCTCCTTTGGTGATTCGGCGACTGGTTACA ...

Embodiment 2

[0072] Embodiment 2 specificity experiment

[0073] Select nucleic acid standards of porcine Jieshen virus, porcine enterovirus 9, porcine foot-and-mouth disease virus, encephalomyocarditis virus, porcine transmissible gastroenteritis, porcine epidemic diarrhea, porcine reproductive and respiratory syndrome virus that do not contain Sapero virus , configure the reaction solution according to the above method, set the reaction conditions, and perform the reaction in Applied Biosystems7500 / 7500 Fast Real-Time PCR system. According to the amplification curve, only porcine Sapero virus was amplified, indicating that the primer had good specificity.

Embodiment 3

[0074] Embodiment 3 clinical verification

[0075] We collected 63 fecal samples from the Zhengyi Pig Farm in Minhang District, Shanghai and the Qibao Campus Pig Farm of Shanghai Jiaotong University. After treatment with 1% phosphate buffer, RNA was extracted using a commercial RNA / DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). Configure the reaction solution according to the above method, set the reaction conditions, and perform the reaction in Applied Biosystems7500 / 7500 Fast Real-Time PCR system. The results showed that 7 samples were amplified, and the Ct value was less than 35, and the Tm value was within the range of 85.62±0.11, which were considered positive samples, with a positive rate of 11.11%. The same samples were verified by ordinary RT-PCR. RT-PCR results showed that amplification occurred in 5 samples, and the positive rate was 7.93%. It shows that SYBR real-time fluorescent quantitative RT-PCR is more sensitive than RT-PCR method, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Porcine Sapelovirus real-time fluorescent quantitative RT-PCR detection method. The method comprises the following steps: designing two primers against the conserved gene fragment of Porcine Sapelovirus, preparing an RNA sample, setting reaction conditions, and carrying out fluorescent quantitative RT-PCR. Results obtained after standard curve making and specificity verification show that the lowest detection limit of the method is in a 10 copy number order of magnitude; and the method has a high specificity, and allows the Porcine Sapelovirus to be separated from Porcine teschovirus, pig enterovirus 9, a foot-and-mouth disease virus, an encephalomyocarditis virus, and porcine transmissible gastroenteritis, porcine epidemic diarrhea and porcine reproductive and respiratory syndrome viruses. Sixty-three pig waste samples are detected, and seven samples are found, so the positive incidence is 11.11%. The method has the characteristics of simplicity, accuracy, high efficiency, fastness, no pollution and the like, is very suitable for the detection and quantification of the Porcine Sapelovirus.

Description

technical field [0001] The invention relates to the field of biotechnology, and is an efficient and rapid detection method for porcine sapero virus. Background technique [0002] Porcine Sapelovirus (Porcine Sapelovirus) is a porcine virus belonging to the family Sapelovirus. It can cause a combination of nervous disorders, reproductive failure, respiratory failure, pneumonia and diarrhea in pigs. The virus can be co-infected with other pig viruses, which brings a very huge economic threat to the pig industry. Therefore, the detection of this virus is an important measure for early prevention, early control and elimination of mutual infection among pig herds. This experiment is aimed at the first strain of Sapero virus (PSV-Csh) in China (gene number: HQ875059). The full length of the virus genome is 7502 base pairs, with only one open reading frame, encoding a polyprotein front body, at the 5' and 3' ends of the genome are the 5'UTR and 3'UTR of the untranslated region o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12Q1/06
CPCC12Q1/70C12Q1/686C12Q2531/113C12Q2545/114C12Q2561/113
Inventor 崔立王春艳郁达义刘雨潇华修国
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com