Non-transgenic genome directed molecule improvement method and application of main crops

A non-transgenic, genome-specific technology, applied in the field of targeted modification of crop genome designated sites, can solve problems such as silencing and gene loss, and achieve the effects of improving quality, rapid targeting, and eliminating safety risks.

Inactive Publication Date: 2014-02-05
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF1 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, technologies such as overexpression and RNAi require that the inserted fragment continue to function in the offspring, which is prone to gene loss and silencing.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Non-transgenic genome directed molecule improvement method and application of main crops
  • Non-transgenic genome directed molecule improvement method and application of main crops
  • Non-transgenic genome directed molecule improvement method and application of main crops

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 against bel Construction of gene TALEN action plasmid

[0030] Step 1. Selection of target sites and TALEN recognition sites

[0031] According to the rice variety Nipponbare ( Oryza sativa L cv. Nipponbare) whole genome sequence, obtained bel For the genome sequence, according to the general design principle of TALEN function, the target fragment is selected as the 18 base sequence from the 22nd to the 39th position of the first exon:

[0032] 5'-gccattctctctgtagct-3',

[0033] The corresponding TALEN left and right arms are identified as the immediately adjacent 15bp (left arm) and 16bp sequences (right arm):

[0034] bel TALEN left arm recognition: 5'-aacgcctacattatt-3'

[0035] bel TALEN right arm recognition: 5'-ggagcaagaagaggat-3'

[0036] Step 2. Targeting vector pTALEN- bel the acquisition

[0037] Using the TALEN vector construction kit (purchased from Shanghai Steinsel Company), based on the principle of GG vector method, the lef...

Embodiment 2

[0039] Example 2 Transformation of Agrobacterium and T 0 Acquisition of transgenic rice

[0040] Step 1: Obtaining Agrobacterium

[0041] The pTALEN obtained from Example 1- bel Binary vector, using the freeze-thaw method to transfer the expression vector into Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) EHA105 (preserved by the Rice Group of the Supervision, Inspection and Testing Center for Components of Genetically Modified Biological Products, Ministry of Agriculture, Anhui Academy of Agricultural Sciences).

[0042] Step 2: Agrobacterium-mediated genetic transformation of rice

[0043] After the chaff is removed from the mature seeds, soak the seeds with 70% alcohol for 1 min, and pour off the alcohol. Soak the seeds in a solution of 50% sodium hypochlorite (the concentration of available chlorine in the stock solution is greater than 4%) containing 1 drop of Tween 20 for 40 min (150 r / min). Pour off the sodium hypochlorite, wash with sterile water...

Embodiment 3

[0047] Example 3 T 0 transgenic rice bel Detection of gene targeting effect

[0048] Use the plant genomic DNA mini-extraction kit to extract each T 0 Leaf DNA of transgenic lines. Using this DNA as a template, bel Gene-specific primers:

[0049] Bel seq FP: GCACCAGAGTCACAGAAACACA

[0050] Bel seq RP: CGAAGGTCACGTCGTGCTCGGT

[0051] amplify bel The 341bp bases near the targeting sequence of the first exon of the gene were identified by sequencing. Sequencing results showed that the targeting sites in 38 transgenic rice plants had different degrees of small fragment DNA deletions, insertions or substitutions ( figure 2 ), resulting in a nonsense mutation, causing bel Gene translation terminates. Among them, 7 transgenic plants had nonsense mutations at the same allele on the two chromosomes, and were selected as materials for further screening.

[0052]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a non-transgenic directed molecule breeding method for crops, an application of a method containing genome directed modification in crop agronomy characteristic improvement, and a non-transgenic progeny screening method, and further relates to an application of the methods in crop conventional breeding. With the method, the sequence structure of the important characteristic determination gene of the crop can be controllably changed so as to directedly obtain the required favorable characteristic, and the filial generation plant with an improvement effect and with no transgenic component can be obtained with genetic segregation so as to accelerate breeding and avoid transgenic safety problem. The breeding method combines advantages of traditional breeding and transgenic breeding.

Description

technical field [0001] The invention relates to the fields of biotechnology and crop breeding. Specifically, the present invention relates to directional modification of designated sites in the genome of crops to obtain relevant beneficial traits; the obtained strains do not contain exogenous artificial DNA fragments, and the genome changes caused by conventional breeding are smaller; the method can be used in The directional molecular improvement of crop varieties can be achieved while ensuring non-transgenic characteristics. Background technique [0002] genetically modified [0003] Traditional crop genetic breeding methods play an important role in improving crop yield and quality. However, in recent years, in the face of increasingly frequent droughts, extreme temperatures and other abiotic stresses and biotic stresses such as pests and diseases, population growth and the pressure of the ecological environment, traditional breeding methods are difficult to meet the ne...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/09C12Q1/68A01H5/00
Inventor魏鹏程杨剑波李浩倪大虎倪金龙李泽福秦瑞英李莉张银萍
OwnerRICE RES ISTITUTE ANHUI ACAD OF AGRI SCI