Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein

A ratiometric fluorescent and sensitive technology, applied in fluorescence/phosphorescence, material excitation analysis, etc., can solve the problems of lack of sensitivity of tumor cells, hysteresis, insufficient drug concentration in tumor sites, etc.

Inactive Publication Date: 2014-03-12
EAST CHINA UNIV OF SCI & TECH
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this therapy has the following defects: ① Insufficient drug concentration at the tumor site; ② Systemic toxicity; ③ Lack of sensitivity to tumor cells higher than normal cells; ④ Appearance of drug-resistant tumor cells
However, there is a hysteresis phenomenon when the precision pH meter detects the pH change, which increases the difficulty in real-time detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein
  • Method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein
  • Method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1. Construction and induced expression of pHluorins prokaryotic expression system

[0041] The whole gene sequence (SEQ ID NO: 1) of artificially synthesized pHluorins was inserted into the XhoI / BamHI site of the pET15b expression vector to obtain the recombinant expression vector pXDC3. The recombinant expression vector was transformed into Escherichia coli BL21 (DE3), and the prokaryotic expression system of pHluorins was constructed.

[0042] Wherein, the full gene sequence of pHluorins is as follows (SEQ ID NO: 1):

[0043] ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGATGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACGAGC...

Embodiment 2

[0048] Example 2, Ultrasonic Disintegration of Bacteria, Purification of Target Protein

[0049] 1. Ultrasonic crushing

[0050] Take out the protein stored at -20°C and thaw it. Then ultrasonically disrupt the bacteria in an ice bath. Ultrasonicator settings: power 100W, ultrasonic 3s, intermittent 5s, ultrasonic 200 times; then take a sample of 100μl of the suspension after ultrasonication and save it for protein electrophoresis, centrifuge at 4°C, 12,000rpm for 20min , separate the supernatant from the precipitate, take 100 μl of the supernatant and 100 μl of the precipitate (dissolved with lysate) for protein electrophoresis, and store at 4°C pending purification.

[0051] 2. Purification

[0052] Turn on the AKTA primer protein purification system and establish a connection with the computer;

[0053] Call the cleaning program preset by the system to clean the whole system with ultrapure water;

[0054] After the cleaning program is finished, install the His Trap HP (...

Embodiment 3

[0062] Embodiment 3, protein dialysis

[0063] Cut the new dialysis bag into a length of about 15cm, and boil it in a solution of 10mM sodium bicarbonate and 1mM ethylenediaminetetraacetic acid (pH8.0) for 10min;

[0064] Rinse the dialysis bag several times with double-distilled water, set aside, submerge the excess dialysis bag in 20% (v / v) ethanol, and store at 4°C;

[0065] Put the purified protein into the dialysis bag and clamp both ends with clips;

[0066] Put the dialysis bag into 500 mL of 1× protein dialysate (dipotassium hydrogen phosphate, potassium dihydrogen phosphate, pH7.4) and dialyze overnight at 4°C, during which time the dialysate was changed several times;

[0067] After dialysis, separate the tubes and store them at -80°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
absorbanceaaaaaaaaaa
Login to View More

Abstract

The invention provides a method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein. According to the invention, the pH-sensitive ratio fluorescent protein is utilized to reflect the pH variation in the reaction process of horseradish oxidase peroxide (HRP) and prodrug indole-3-acetic acid (IAA), and the result of pH variation can be obtained through detection of a fluorescence microplate reader simply, so that the purpose of monitoring the reaction in real time can be achieved.

Description

technical field [0001] The invention belongs to the field of biotechnology; more specifically, the invention relates to a method for detecting enzyme-prodrug reaction using a pH-sensitive ratio fluorescent protein. Background technique [0002] Under the conditions of existing science and technology and medical level, the main method for human to treat tumor is chemotherapy. Chemotherapy is the use of anti-tumor drugs to treat tumors. Clinical application began in the 1940s. With the development of tumor cell dynamics and clinical pharmacology, and the advent of various anti-tumor drugs, coupled with the use of combined chemotherapy and mature chemotherapy regimens , a small number of tumors can be cured, such as acute lymphoblastic leukemia, Hodgkin's disease and so on. In the past ten years, researches on biological response modifiers and differentiation-inducing agents have been conducted at home and abroad, which have been organically combined with anti-tumor drugs to i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N21/64
Inventor 王平曹晓丹刘蕙
Owner EAST CHINA UNIV OF SCI & TECH