Method for detecting enzyme-prodrug reaction by applying pH-sensitive ratio fluorescent protein
A ratiometric fluorescent and sensitive technology, applied in fluorescence/phosphorescence, material excitation analysis, etc., can solve the problems of lack of sensitivity of tumor cells, hysteresis, insufficient drug concentration in tumor sites, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1. Construction and induced expression of pHluorins prokaryotic expression system
[0041] The whole gene sequence (SEQ ID NO: 1) of artificially synthesized pHluorins was inserted into the XhoI / BamHI site of the pET15b expression vector to obtain the recombinant expression vector pXDC3. The recombinant expression vector was transformed into Escherichia coli BL21 (DE3), and the prokaryotic expression system of pHluorins was constructed.
[0042] Wherein, the full gene sequence of pHluorins is as follows (SEQ ID NO: 1):
[0043] ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGATGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACGAGC...
Embodiment 2
[0048] Example 2, Ultrasonic Disintegration of Bacteria, Purification of Target Protein
[0049] 1. Ultrasonic crushing
[0050] Take out the protein stored at -20°C and thaw it. Then ultrasonically disrupt the bacteria in an ice bath. Ultrasonicator settings: power 100W, ultrasonic 3s, intermittent 5s, ultrasonic 200 times; then take a sample of 100μl of the suspension after ultrasonication and save it for protein electrophoresis, centrifuge at 4°C, 12,000rpm for 20min , separate the supernatant from the precipitate, take 100 μl of the supernatant and 100 μl of the precipitate (dissolved with lysate) for protein electrophoresis, and store at 4°C pending purification.
[0051] 2. Purification
[0052] Turn on the AKTA primer protein purification system and establish a connection with the computer;
[0053] Call the cleaning program preset by the system to clean the whole system with ultrapure water;
[0054] After the cleaning program is finished, install the His Trap HP (...
Embodiment 3
[0062] Embodiment 3, protein dialysis
[0063] Cut the new dialysis bag into a length of about 15cm, and boil it in a solution of 10mM sodium bicarbonate and 1mM ethylenediaminetetraacetic acid (pH8.0) for 10min;
[0064] Rinse the dialysis bag several times with double-distilled water, set aside, submerge the excess dialysis bag in 20% (v / v) ethanol, and store at 4°C;
[0065] Put the purified protein into the dialysis bag and clamp both ends with clips;
[0066] Put the dialysis bag into 500 mL of 1× protein dialysate (dipotassium hydrogen phosphate, potassium dihydrogen phosphate, pH7.4) and dialyze overnight at 4°C, during which time the dialysate was changed several times;
[0067] After dialysis, separate the tubes and store them at -80°C.
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| absorbance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 