Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genetically engineered attenuated strains of edwardsiella tarda (E.tarda) and application thereof

A technology of Edwards tarda and genetic engineering is applied in the field of genetically engineered attenuated strains of Edwardsiella tarda, which can solve problems such as affecting the application effect of genetically engineered strains and affecting the immune protection effect of attenuated vaccines.

Active Publication Date: 2014-03-26
YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The strain difference of the pathogenic material will directly affect the application effect of its genetically engineered strain, and then also affect the immune protection effect of the attenuated vaccine prepared by it

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered attenuated strains of edwardsiella tarda (E.tarda) and application thereof
  • Genetically engineered attenuated strains of edwardsiella tarda (E.tarda) and application thereof
  • Genetically engineered attenuated strains of edwardsiella tarda (E.tarda) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1: the cultivation of Edwardsiella tarda genetically engineered attenuated strain

[0020] Genetic Engineering Attenuated Strain E.tarda of Edwardsiella tarda △EvpC 、E.tarda △EvpCΔEsrB 、E.tarda ΔEvpCΔEsrBΔPstB and E. tarda ΔEvpCΔEsrBΔPstC It can be cultured in LB medium (tryptone 10g, yeast extract 5g, NaCl10g, deionized water to 1L, pH7.0), TSB medium (Beijing Land Bridge Technology Co., Ltd.) or 2216E medium (according to culture The presence or absence of seawater in the base component, the medium is divided into two types, one: yeast extract 1g, tryptone 5g, FePO 4 0.1g, dilute seawater to 1L, pH7.6-7.8; second: yeast extract 1g, tryptone 5g, FePO 4 0.1g, NaCl34g, deionized water to 1L, pH7.6-7.8), the preparation of the solid plate of the above medium needs to add 2% agar additionally. The method of strain cultivation is as follows: pick a small amount of strains stored at -80°C and streak on the solid plate of the above-mentioned medium, and cultur...

Embodiment 2

[0021] Embodiment 2: Edwardsiella tarda genetically engineered attenuated vaccine E.tarda △EvpC Strain construction method

[0022] (1) Amplification and connection of the upstream and downstream nucleotide sequences of the EvpC gene

[0023] Using the DNA of Edwardsiella tarda 1101 strain (preservation number: CGMCC No.7197) as a template, primers EvpC-up-for / EvpC-up-rev were used to amplify the upstream fragment F1 (826bp) of the EvpC gene, and the obtained sequence was recorded as is SEQ ID NO:1. The downstream fragment F2 (583bp) of the EvpC gene was amplified with primers EvpC-down-for / EvpC-down-rev, and the obtained sequence was recorded as SEQ ID NO:2. Sequencing and phylogenetic analysis of SEQ ID NO: 1 and 2 showed that the above two sequences had the sequence characteristics of the upper and lower reaches of the EvpC gene of the Edwardsiella tarda strain.

[0024] The above primer sequences are as follows:

[0025] EvpC-up-for: AAGGTACCGGTCGAGTCATTCAATTTT

[002...

Embodiment 3

[0035] Embodiment 3: Edwardsiella tarda genetically engineered attenuated vaccine E.tarda △EvpCΔEsrB Strain construction method

[0036] (1) Amplification and connection of the upstream and downstream nucleotide sequences of the EsrB gene

[0037] The EsrB gene upstream fragment F3 (860bp) was amplified with the primer EsrB-up-for / EsrB-up-rev using the Edwardsiella tarda 1101 strain DNA as a template, and the obtained sequence was recorded as SEQ ID NO:3. The downstream fragment F4 (765bp) of the EsrB gene was amplified with primers EsrB-down-for / EsrB-down-rev, and the obtained sequence was recorded as SEQ ID NO:4. Sequencing and phylogenetic analysis of SEQ ID NO: 3 and 4 showed that the above two sequences had the sequence characteristics of the upper and lower reaches of the EsrB gene of Edwardsiella tarda strain 1101. The above primer sequences are as follows:

[0038] EsrB-up-for: AAGGTACCGGCGACAATCCCGATCTG

[0039] EsrB-up-rev: ATCCGTAATCTCTTGGCGGAGCTGAGCAACTGGG

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides four gene deletion mutants of wild edwardsiella tarda (E.tarda) and derivative strains thereof. The four gene deletion mutants are respectively an E.tarda<deltaEvpC> strain with an EvpC gene losing function and derivative strains thereof, an E.tarda<deltaEvpCdeltaEsrB> strain with an EsrB gene losing function and derivative strains thereof, an E.tarda<deltaEvpCdeltaEsrBdeltaPstB> strain with a PstB gene losing function and derivative strains thereof, and an E.tarda<deltaEvpCdeltaEsrBdeltaPstC> strain with a PstC gene losing function and derivative strains thereof. 1-3 genes such as EvpC, EsrB, PstB, PstC and the like of the attenuated strains have parts causing loss of function or suffer from complete deletion, point mutation, shifting or insertion. Compared with a wild 1101 strain or other virulent strains, the E.tarda<deltaEvpC> strain, the E.tarda<deltaEvpCdeltaEsrB> strain, the E.tarda<deltaEvpCdeltaEsrBdeltaPstB> strain and the E.tarda<deltaEvpCdeltaEsrBdeltaPstC> strain have the advantage that the virulence does not exceed 1 / 40, 1 / 400, 1 / 4000 and 1 / 4000 of the virulence of the wild E.tarda 1101 strain or other virulent strains. The genetically engineered attenuated strains of E.tarda can be applied as attenuated vaccine strains of E.tarda, genetic engineering vectors or probiotics.

Description

technical field [0001] The invention relates to the field of microbial genetic engineering technology and immunology of aquaculture animals, and specifically relates to a genetically engineered attenuated strain of Edwardsiella tarda and its application. Background technique [0002] Edwardsiella tarda was first isolated from eel (Anguilla japanica) by Hoshina (1962), and belongs to the same Enterobacteriaceae Edwardsiella as E.ictaluri and E.hoshinae Bacteria. Edwardsiella tarda is pathogenic to a variety of fish species. It has been reported to infect the following species: channel catfish (Ictalurus punctatus), largemouth bass (Micopterus salmoides), eel (A.japonica), mullet (Mugil cephalus ), Ploughtooth seabream (Evynnis japonica), tilapia (Tilapia nilotica), Chinook salmon (Oncorhynchus tshawytscha), red snapper (Chrysophrys major), five bream (Seriola quinqueradiata), flounder (Paralichthys olivaceus), common carp ( Cyprinus carpio), sea bass (Morone saxatilis), tur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A61K39/02A61K48/00A61P31/04A61P37/04C12N1/21C12R1/01
Inventor 黄倢谢国驷莫照兰王秀华许华张庆利隋虎辰杨春志李晨
Owner YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com