Genetically engineered attenuated strains of edwardsiella tarda (E.tarda) and application thereof
A technology of Edwards tarda and genetic engineering is applied in the field of genetically engineered attenuated strains of Edwardsiella tarda, which can solve problems such as affecting the application effect of genetically engineered strains and affecting the immune protection effect of attenuated vaccines.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Embodiment 1: the cultivation of Edwardsiella tarda genetically engineered attenuated strain
[0020] Genetic Engineering Attenuated Strain E.tarda of Edwardsiella tarda △EvpC 、E.tarda △EvpCΔEsrB 、E.tarda ΔEvpCΔEsrBΔPstB and E. tarda ΔEvpCΔEsrBΔPstC It can be cultured in LB medium (tryptone 10g, yeast extract 5g, NaCl10g, deionized water to 1L, pH7.0), TSB medium (Beijing Land Bridge Technology Co., Ltd.) or 2216E medium (according to culture The presence or absence of seawater in the base component, the medium is divided into two types, one: yeast extract 1g, tryptone 5g, FePO 4 0.1g, dilute seawater to 1L, pH7.6-7.8; second: yeast extract 1g, tryptone 5g, FePO 4 0.1g, NaCl34g, deionized water to 1L, pH7.6-7.8), the preparation of the solid plate of the above medium needs to add 2% agar additionally. The method of strain cultivation is as follows: pick a small amount of strains stored at -80°C and streak on the solid plate of the above-mentioned medium, and cultur...
Embodiment 2
[0021] Embodiment 2: Edwardsiella tarda genetically engineered attenuated vaccine E.tarda △EvpC Strain construction method
[0022] (1) Amplification and connection of the upstream and downstream nucleotide sequences of the EvpC gene
[0023] Using the DNA of Edwardsiella tarda 1101 strain (preservation number: CGMCC No.7197) as a template, primers EvpC-up-for / EvpC-up-rev were used to amplify the upstream fragment F1 (826bp) of the EvpC gene, and the obtained sequence was recorded as is SEQ ID NO:1. The downstream fragment F2 (583bp) of the EvpC gene was amplified with primers EvpC-down-for / EvpC-down-rev, and the obtained sequence was recorded as SEQ ID NO:2. Sequencing and phylogenetic analysis of SEQ ID NO: 1 and 2 showed that the above two sequences had the sequence characteristics of the upper and lower reaches of the EvpC gene of the Edwardsiella tarda strain.
[0024] The above primer sequences are as follows:
[0025] EvpC-up-for: AAGGTACCGGTCGAGTCATTCAATTTT
[002...
Embodiment 3
[0035] Embodiment 3: Edwardsiella tarda genetically engineered attenuated vaccine E.tarda △EvpCΔEsrB Strain construction method
[0036] (1) Amplification and connection of the upstream and downstream nucleotide sequences of the EsrB gene
[0037] The EsrB gene upstream fragment F3 (860bp) was amplified with the primer EsrB-up-for / EsrB-up-rev using the Edwardsiella tarda 1101 strain DNA as a template, and the obtained sequence was recorded as SEQ ID NO:3. The downstream fragment F4 (765bp) of the EsrB gene was amplified with primers EsrB-down-for / EsrB-down-rev, and the obtained sequence was recorded as SEQ ID NO:4. Sequencing and phylogenetic analysis of SEQ ID NO: 3 and 4 showed that the above two sequences had the sequence characteristics of the upper and lower reaches of the EsrB gene of Edwardsiella tarda strain 1101. The above primer sequences are as follows:
[0038] EsrB-up-for: AAGGTACCGGCGACAATCCCGATCTG
[0039] EsrB-up-rev: ATCCGTAATCTCTTGGCGGAGCTGAGCAACTGGG
[...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com