A method for preparing nucleic acid mass spectrometry for detecting colorectal cancer k-ras gene mutation and its products
A gene and nucleic acid technology, applied in the field of gene detection, can solve the problems of high cost, time-consuming, cumbersome steps, etc., achieve high accuracy, high sensitivity, and reduce the cost of consumables
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0081] Example 1. Primer design.
[0082] For the DNA fragment of K-ras gene, design the corresponding specific PCR primer core sequence (SEQ ID No: 1 and SEQ ID No: 2), this pair of primers can amplify the coding sequence of K-ras gene, containing 12 and 13 codons 83bp inside.
[0083] SEQ ID No: 1: 5'-AAGGCCTGCTGAAAATGACTG-3'
[0084] SEQ ID No: 2: 5'-TAGCTGTATCGTCAAGGCACTCT-3'
[0085] The amplified sequence of SEQ ID NO: 3 (83 bp) is as follows (the underlined region is the 12 and 13 codons, and only the wild type is listed):
[0086] SEQ ID No: 3: AAGGCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCT G GTGGC GTAGGCAAGAGTGCCTTGACGATACAGCTA
[0087] In order for the reverse transcriptase to recognize the PCR product and prevent the PCR primers from entering the detection window of the mass spectrometer to interfere with the detection effect, it is also necessary to add specific sequences (lowercase letters) to the 5'ends of SEQ ID No:1 and SEQ ID No:2. Therefore, the actually synthesized ...
Embodiment 2
[0093] Example 2. Sample preparation.
[0094] Through molecular cloning techniques such as plasmid construction and site-directed mutagenesis, the plasmids containing K-ras gene wild-type and 7 mutations were constructed respectively, a total of 8 kinds of samples were WT (wild-type) and 12A (12 codon GGT> GCT), 12C (12 codon GGT> TGT), 12D (12 codon GGT> GAT), 12R (12 codon GGT> CGT), 12S (12 codon GGT> AGT), 12V (12 codon GGT> GTT), 13D (13 codon GGC> GAC). This operation uses basic molecular biology techniques, which will not be repeated.
[0095] Clinical colorectal cancer patient 1. When the tumor tissue is surgically removed, a fresh tissue piece (the size of a soybean) is taken, and the patient’s tumor is extracted with a blood / cell / tissue genome extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304) Genomic DNA, set as sample 1, and reserve at -20°C.
[0096] For patients with colorectal cancer after surgery, venous blood was collected, serum (about 1ml)...
Embodiment 3
[0099] Example 3: Analysis and verification of the difference between wild-type and mutant nuclease digestion fingerprints of codons 12 and 13 of K-ras gene.
[0100] Through theoretical analysis of the wild-type and mutant-type sequences, the wild-type and the mutant-type will produce different nuclease digestion fingerprints. As shown in Table 2, the wild-type DNA fragments will produce 3738.35 peaks through digestion, and no It has peaks such as 1577.98, 2196.38, 2485.56, 3778.38 and 3794.37, while the mutant DNA fragments are just the opposite. After digestion and mass spectroscopy, one or more of the peaks of 1577.98, 2196.38, 2485.56, 3778.38 and 3794.37 will be generated. There is a 3738.35 peak. Therefore, it is theoretically possible to determine whether the wild-type is present by the presence of the 3738.35 peak, and whether one or more of the peaks such as 1577.98, 2196.38, 2485.56, 3778.38 and 3794.37 are present to determine whether there is a mutant.
[0101] Table ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More