Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for preparing nucleic acid mass spectrometry for detecting colorectal cancer k-ras gene mutation and its products

A gene and nucleic acid technology, applied in the field of gene detection, can solve the problems of high cost, time-consuming, cumbersome steps, etc., achieve high accuracy, high sensitivity, and reduce the cost of consumables

Active Publication Date: 2015-09-09
BIOYONG TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing detection techniques either have cumbersome steps, take too long, or have to divide multiple reactions, resulting in high cost.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for preparing nucleic acid mass spectrometry for detecting colorectal cancer k-ras gene mutation and its products
  • A method for preparing nucleic acid mass spectrometry for detecting colorectal cancer k-ras gene mutation and its products
  • A method for preparing nucleic acid mass spectrometry for detecting colorectal cancer k-ras gene mutation and its products

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Example 1. Primer design.

[0082] For the DNA fragment of K-ras gene, design the corresponding specific PCR primer core sequence (SEQ ID No: 1 and SEQ ID No: 2), this pair of primers can amplify the coding sequence of K-ras gene, containing 12 and 13 codons 83bp inside.

[0083] SEQ ID No: 1: 5'-AAGGCCTGCTGAAAATGACTG-3'

[0084] SEQ ID No: 2: 5'-TAGCTGTATCGTCAAGGCACTCT-3'

[0085] The amplified sequence of SEQ ID NO: 3 (83 bp) is as follows (the underlined region is the 12 and 13 codons, and only the wild type is listed):

[0086] SEQ ID No: 3: AAGGCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCT G GTGGC GTAGGCAAGAGTGCCTTGACGATACAGCTA

[0087] In order for the reverse transcriptase to recognize the PCR product and prevent the PCR primers from entering the detection window of the mass spectrometer to interfere with the detection effect, it is also necessary to add specific sequences (lowercase letters) to the 5'ends of SEQ ID No:1 and SEQ ID No:2. Therefore, the actually synthesized ...

Embodiment 2

[0093] Example 2. Sample preparation.

[0094] Through molecular cloning techniques such as plasmid construction and site-directed mutagenesis, the plasmids containing K-ras gene wild-type and 7 mutations were constructed respectively, a total of 8 kinds of samples were WT (wild-type) and 12A (12 codon GGT> GCT), 12C (12 codon GGT> TGT), 12D (12 codon GGT> GAT), 12R (12 codon GGT> CGT), 12S (12 codon GGT> AGT), 12V (12 codon GGT> GTT), 13D (13 codon GGC> GAC). This operation uses basic molecular biology techniques, which will not be repeated.

[0095] Clinical colorectal cancer patient 1. When the tumor tissue is surgically removed, a fresh tissue piece (the size of a soybean) is taken, and the patient’s tumor is extracted with a blood / cell / tissue genome extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304) Genomic DNA, set as sample 1, and reserve at -20°C.

[0096] For patients with colorectal cancer after surgery, venous blood was collected, serum (about 1ml)...

Embodiment 3

[0099] Example 3: Analysis and verification of the difference between wild-type and mutant nuclease digestion fingerprints of codons 12 and 13 of K-ras gene.

[0100] Through theoretical analysis of the wild-type and mutant-type sequences, the wild-type and the mutant-type will produce different nuclease digestion fingerprints. As shown in Table 2, the wild-type DNA fragments will produce 3738.35 peaks through digestion, and no It has peaks such as 1577.98, 2196.38, 2485.56, 3778.38 and 3794.37, while the mutant DNA fragments are just the opposite. After digestion and mass spectroscopy, one or more of the peaks of 1577.98, 2196.38, 2485.56, 3778.38 and 3794.37 will be generated. There is a 3738.35 peak. Therefore, it is theoretically possible to determine whether the wild-type is present by the presence of the 3738.35 peak, and whether one or more of the peaks such as 1577.98, 2196.38, 2485.56, 3778.38 and 3794.37 are present to determine whether there is a mutant.

[0101] Table ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting mutation of codons 12 and 13 of a K-ras gene. The method is based on a mass spectrometric detection nuclease cleavage fingerprint technology and comprises the steps of PCR (Polymerase Chain Reaction) amplification, PCR product purification, reverse transcription, nuclease cleavage, nuclease cleavage product purification, mass spectrometer detection and the like. To detect whether the codons 12 and 13 of the K-ras gene mutate based on the method can provide a reference for clinic judgment of patient prognosis and determination of a dosage schedule.

Description

Technical field [0001] The present invention belongs to the field of gene detection, and relates to a preparation method of nucleic acid mass spectrometry for detecting colorectal cancer K-ras gene mutations and products thereof, and specifically relates to the use of nucleic acid fingerprint mass spectrometry methods to detect a K-ras gene 12, 13 codons and related products. Background technique [0002] K-ras gene (GenBank: NC_000012) is a proto-oncogene in the RAS gene superfamily. It is located on the short arm of chromosome 12. The protein encoded by it is an important protein in the signal transduction pathway of cell surface receptors such as EGFR. It plays a key role in the occurrence and development of tumors. It participates in cell cycle regulation through downstream signaling proteins, and is closely related to tumor cell survival, proliferation, migration and diffusion, and angiogenesis. [0003] Under normal physiological conditions, cells are stimulated by the exte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q1/6886C12Q2600/106C12Q2600/156C12Q2565/627
Inventor 张学记马庆伟赵洪斌张海燕林燕
Owner BIOYONG TECH