HCV (Hepatitis c virus) genotype detection kit

A kind of technology of hepatitis C virus, detection kit

Active Publication Date: 2014-04-09
SANSURE BIOTECH INC
View PDF10 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are many deficiencies in this type of kit: 1) The detection sensitivity is low, about 10000IU/ml; the detection range is narrow, generally between 1.00E+04IU/ml~1.00E+07IU/ml. Samples with greater than 5.00E+07IU/ml) and low values ​​(less than 1.00E+04IU/ml) cannot be detected; 2) For HCV genotype coverage is not complete, only subtypes under one of the genotypes can be detected; 3) Phenol - The chloroform method is the most classic RNA extraction method, but it is cu

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HCV (Hepatitis c virus) genotype detection kit
  • HCV (Hepatitis c virus) genotype detection kit
  • HCV (Hepatitis c virus) genotype detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] Embodiment 1: provide a kind of HCV genotype detection kit

[0091] A HCV genotype detection kit, which consists of at least the following independent components:

[0092] HCV type 1 and type 3 PCR reaction solution: 10 μl of 5×PCR reaction buffer (included with Tth polymerase), 0.2 mmol / L deoxyribonucleoside triphosphate, 0.2 μmol / L~0.4 μmol / L for target polynucleoside Upstream and downstream primers HCV1-F, HCV1-R, HCV3-F, HCV3-R for acid amplification, 0.2μmol / L~0.4μmol / L probes HCV1-P, HCV3-P for target polynucleotide detection , the base pair sequences of the upstream and downstream primers used for target polynucleotide amplification and the probes used for target polynucleotide detection are respectively:

[0093] Upstream primer HCV1-F: 5'-AGGAAGACTTCCGAGCGGTC-3';

[0094] Downstream primer HCV1-R: 5'-TGCCATAGAGGGGCCAAGG-3';

[0095] Probe HCV1-P: 5'FAM-TACCCGGGCTGCGCCCAGG-BHQ13';

[0096] Upstream primer HCV3-F: 5'-GTCCTTTCTTGGAACAACCCGC-3';

[0097] Downs...

Embodiment 2

[0114] Embodiment 2: provide a kind of HCV genotype detection kit

[0115] A kind of HCV genotype detection kit, it also contains following several independently existing components except containing each component existing independently in embodiment 1:

[0116] Internal standard (positive internal control): a recombinant of a 100-base-pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, with a concentration of 1.00E+03IUs / ml~1.00E+06IUs / ml; 100 bases The sequence of base pairs is as follows:

[0117] 5'-CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTATTCGTAGCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG-3'

Embodiment 3

[0118] Embodiment 3: provide a kind of HCV genotype detection kit

[0119] A kind of HCV genotype detection kit, it also contains following several independently existing components except containing each component existing independently in embodiment 2:

[0120] HCV typing enzyme mixture: Tth enzyme 10U / μl~150U / μl, 1U / μl~10U / μl H-Taq DNA polymerase;

[0121] HCV typing positive control: calibrate the pseudovirus of known concentration, the concentration is 1.00~5.00E+05IU / ml.

[0122] HCV typing negative control: sterile saline.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to view more

Abstract

The invention relates to a HCV (hepatitis c virus) genotype detection kit. The kit extracts a sample nucleic acid by using a magnetic bead method; by using a real-time fluorescence quantitative PCR (polymerase chain reaction) technology, and taking a highly conserved area of a HCV genome as an amplification target, a specific primer and a TaqMan probe are designed, then HCV genes are subjected to rapid and accurate genotyping detection on a real-time fluorescence PCR instrument by PCR amplification, and an internal standard is added in a system, so that false negative results can be effectively prevented.

Description

technical field [0001] The invention belongs to the technical field of hepatitis C virus genotype detection and relates to a hepatitis C virus genotype detection kit. Background technique [0002] The magnetic bead method is a nucleic acid extraction method that has developed rapidly and is widely used in recent years. Its advantages over traditional methods can be summarized as follows: large variability in extraction volume, strong specificity of adsorbed nucleic acids, high purity, and realizable Automate operations. [0003] Real-time fluorescent PCR technology (FQ-PCR) integrates PCR, molecular hybridization and photochemistry, so that the whole process of PCR amplification and product analysis is carried out under single-tube closed conditions. Compared with other detection technologies, real-time fluorescent PCR technology has the following advantages: (1) Compared with immunological detection, it has higher sensitivity. Theoretically, only one gene copy can be detec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/686C12Q1/70C12Q2545/101C12Q2561/101C12Q2531/113
Inventor 戴立忠黄河邓中平王军
Owner SANSURE BIOTECH INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap