HCV (Hepatitis c virus) genotype detection kit

A technology of hepatitis C virus and detection kit, which is applied in the direction of microbe-based methods, microbiological measurement/testing, microbiology, etc., and can solve the problems of incomplete coverage, difficult, cumbersome operation, etc.

Active Publication Date: 2015-03-11
SANSURE BIOTECH INC
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are many deficiencies in this type of kit: 1) The detection sensitivity is low, about 10000IU / ml; the detection range is narrow, generally between 1.00E+04IU / ml~1.00E+07IU / ml. Samples with greater than 5.00E+07IU / ml) and low values ​​(less than 1.00E+04IU / ml) cannot be detected; 2) For HCV genotype coverage is not complete, only subtypes under one of the genotypes can be detected; 3) Phenol - The chloroform method is the most classic RNA extraction method, but it is cumbersome to operate, requires high equipment and personnel operations, the detection rate of samples with low viral load is low, and the reagents used have certain toxicity; the column extraction method does not require high-speed centrifugation, but Frequent replacement of centrifuge tubes is required, which takes a long time and has poor specificity; 4) PCR inhibitors in samples cannot be effectively removed (such as blood lipids, strong hemolysis, etc.); Widely carried out

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HCV (Hepatitis c virus) genotype detection kit
  • HCV (Hepatitis c virus) genotype detection kit
  • HCV (Hepatitis c virus) genotype detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] Embodiment 1: provide a kind of HCV genotype detection kit

[0091] A HCV genotype detection kit, which consists of at least the following independent components:

[0092] HCV type 1 and type 3 PCR reaction solution: 10 μl of 5×PCR reaction buffer (included with Tth polymerase), 0.2 mmol / L deoxyribonucleoside triphosphate, 0.2 μmol / L~0.4 μmol / L for target polynucleoside Upstream and downstream primers HCV1-F, HCV1-R, HCV3-F, HCV3-R for acid amplification, 0.2μmol / L~0.4μmol / L probes HCV1-P, HCV3-P for target polynucleotide detection , the base pair sequences of the upstream and downstream primers used for target polynucleotide amplification and the probes used for target polynucleotide detection are respectively:

[0093] Upstream primer HCV1-F: 5'-AGGAAGACTTCCGAGCGGTC-3';

[0094] Downstream primer HCV1-R: 5'-TGCCATAGAGGGGCCAAGG-3';

[0095] Probe HCV1-P: 5'FAM-TACCCGGGCTGCGCCCAGG-BHQ13';

[0096] Upstream primer HCV3-F: 5'-GTCCTTTCTTGGAACAACCCGC-3';

[0097] Downs...

Embodiment 2

[0114] Embodiment 2: provide a kind of HCV genotype detection kit

[0115] A kind of HCV genotype detection kit, it also contains following several independently existing components except containing each component existing independently in embodiment 1:

[0116] Internal standard (positive internal control): a recombinant of a 100-base-pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, with a concentration of 1.00E+03IUs / ml~1.00E+06IUs / ml; 100 bases The sequence of base pairs is as follows:

[0117] 5'-CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTATTCGTAGCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG-3'

Embodiment 3

[0118] Embodiment 3: provide a kind of HCV genotype detection kit

[0119] A kind of HCV genotype detection kit, it also contains following several independently existing components except containing each component existing independently in embodiment 2:

[0120] HCV typing enzyme mixture: Tth enzyme 10U / μl~150U / μl, 1U / μl~10U / μl H-Taq DNA polymerase;

[0121] HCV typing positive control: calibrate the pseudovirus of known concentration, the concentration is 1.00~5.00E+05IU / ml.

[0122] HCV typing negative control: sterile saline.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a HCV (hepatitis c virus) genotype detection kit. The kit extracts a sample nucleic acid by using a magnetic bead method; by using a real-time fluorescence quantitative PCR (polymerase chain reaction) technology, and taking a highly conserved area of a HCV genome as an amplification target, a specific primer and a TaqMan probe are designed, then HCV genes are subjected to rapid and accurate genotyping detection on a real-time fluorescence PCR instrument by PCR amplification, and an internal standard is added in a system, so that false negative results can be effectively prevented.

Description

technical field [0001] The invention belongs to the technical field of hepatitis C virus genotype detection and relates to a hepatitis C virus genotype detection kit. Background technique [0002] The magnetic bead method is a nucleic acid extraction method that has developed rapidly and is widely used in recent years. Its advantages over traditional methods can be summarized as follows: large variability in extraction volume, strong specificity of adsorbed nucleic acids, high purity, and realizable Automate operations. [0003] Real-time fluorescent PCR technology (FQ-PCR) integrates PCR, molecular hybridization and photochemistry, so that the whole process of PCR amplification and product analysis is carried out under single-tube closed conditions. Compared with other detection technologies, real-time fluorescent PCR technology has the following advantages: (1) Compared with immunological detection, it has higher sensitivity. Theoretically, only one gene copy can be detec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/686C12Q1/70C12Q2545/101C12Q2561/101C12Q2531/113
Inventor戴立忠黄河邓中平
OwnerSANSURE BIOTECH INC