HCV (Hepatitis c virus) genotype detection kit
A technology of hepatitis C virus and detection kit, which is applied in the direction of microbe-based methods, microbiological measurement/testing, microbiology, etc., and can solve the problems of incomplete coverage, difficult, cumbersome operation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0090] Embodiment 1: provide a kind of HCV genotype detection kit
[0091] A HCV genotype detection kit, which consists of at least the following independent components:
[0092] HCV type 1 and type 3 PCR reaction solution: 10 μl of 5×PCR reaction buffer (included with Tth polymerase), 0.2 mmol / L deoxyribonucleoside triphosphate, 0.2 μmol / L~0.4 μmol / L for target polynucleoside Upstream and downstream primers HCV1-F, HCV1-R, HCV3-F, HCV3-R for acid amplification, 0.2μmol / L~0.4μmol / L probes HCV1-P, HCV3-P for target polynucleotide detection , the base pair sequences of the upstream and downstream primers used for target polynucleotide amplification and the probes used for target polynucleotide detection are respectively:
[0093] Upstream primer HCV1-F: 5'-AGGAAGACTTCCGAGCGGTC-3';
[0094] Downstream primer HCV1-R: 5'-TGCCATAGAGGGGCCAAGG-3';
[0095] Probe HCV1-P: 5'FAM-TACCCGGGCTGCGCCCAGG-BHQ13';
[0096] Upstream primer HCV3-F: 5'-GTCCTTTCTTGGAACAACCCGC-3';
[0097] Downs...
Embodiment 2
[0114] Embodiment 2: provide a kind of HCV genotype detection kit
[0115] A kind of HCV genotype detection kit, it also contains following several independently existing components except containing each component existing independently in embodiment 1:
[0116] Internal standard (positive internal control): a recombinant of a 100-base-pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, with a concentration of 1.00E+03IUs / ml~1.00E+06IUs / ml; 100 bases The sequence of base pairs is as follows:
[0117] 5'-CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTATTCGTAGCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG-3'
Embodiment 3
[0118] Embodiment 3: provide a kind of HCV genotype detection kit
[0119] A kind of HCV genotype detection kit, it also contains following several independently existing components except containing each component existing independently in embodiment 2:
[0120] HCV typing enzyme mixture: Tth enzyme 10U / μl~150U / μl, 1U / μl~10U / μl H-Taq DNA polymerase;
[0121] HCV typing positive control: calibrate the pseudovirus of known concentration, the concentration is 1.00~5.00E+05IU / ml.
[0122] HCV typing negative control: sterile saline.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 