Primer pair, castanopsis hystrix SSR4 (Simple Sequence Repeat 4) marker and preparation method and application thereof

A primer pair, red cone technology, applied in biochemical equipment and methods, DNA preparation, microbial assay/inspection, etc., can solve problems such as inability to directly apply molecular marker-assisted breeding and QTL positioning, poor stability, etc.

Inactive Publication Date: 2014-04-23
GUANGXI FORESTRY RES INST
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although scholars at home and abroad have used multiple markers such as ISSR and RAPD to study the genetic diversity of red cone populations, the genetic structure of red cone populations, and the genetic relationship and distance between red cones of different provenances, the two markers of ISSR and RAPD All are dominant markers with poor stability and cannot be directly applied to molecular marker-assisted breeding and QTL mapping

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair, castanopsis hystrix SSR4 (Simple Sequence Repeat 4) marker and preparation method and application thereof
  • Primer pair, castanopsis hystrix SSR4 (Simple Sequence Repeat 4) marker and preparation method and application thereof
  • Primer pair, castanopsis hystrix SSR4 (Simple Sequence Repeat 4) marker and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0028] Extraction and Restriction Digestion of Total DNA from Rhododendron

[0029] Select the young leaves of C. erythraea and extract the nuclear genome by CTAB method; digest with EcoRV for 3 hours at 37°C and inactivate endonuclease at 65°C for 20 minutes; reaction system 20μL, including 2.0μL of 10×Buffer, 1.0μL of EcoRV endonuclease, 2μL DNA, 15.0μL sterilized double distilled water;

[0030] Connector connection

[0031] Steps EcoRV digested red cone genomic DNA is connected to the upper and lower linkers (upper linker sequence GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT, sequence listing SEQ.ID.No.4; lower linker sequence ACCAGCCC-NH 2 , Sequence Listing SEQ.ID.No.5); 60μL ligation system contains 9μL of digested red cone genomic DNA, and the upper and lower adapters are 100pmol each; the ligation reaction is carried out under 1x T4 ligase buffer conditions and ligated overnight at 16°C; ligation The latter mixture was reacted at 65°C for 20 minutes to inactivate the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer pair, a castanopsis hystrix SSR4 (Simple Sequence Repeat 4) marker and a preparation method and application thereof. According to the preparation method, the total DNA (Deoxyribonucleic Acid) of castanopsis hystrix is subjected to PCR (Polymerase Chain Reaction) amplification by using the specific primer pair HZ4, thereby obtaining the SSR4 marker. The method is simple and feasible and is simple and convenient in operation; shown by tests which are carried out in members of two natural castanopsis hystrix populations and among the members, the obtained SSR has relatively high polymorphism. The castanopsis hystrix SSR4 marker is a co-dominant marker; compared with other molecular markers, the SSR marker is good in repeatability and high in reliability, can be applied to the genetic diversity evaluation of castanopsis hystrix, the genetic map construction of castanopsis hystrix, the research on the spatial distribution pattern of the genetic variation of castanopsis hystrix population and the origination and evolution of castanopsis hystrix and the standardization of target genes, and can also be applied to the molecular marker assisted breeding and QTL (Quantitative Trait Locus) research of castanopsis hystrix.

Description

Technical field [0001] The invention belongs to the technical field of molecular markers in biological sciences, and particularly relates to a red cone SSR4 marker, a primer pair, and a preparation method and application thereof. Background technique [0002] Castanopsis hystrix (Castanopsis hystrix) is an evergreen tree of the Fagaceae genus Castanopsis. It is an important native broad-leaved, high-quality and precious timber species in South China. It grows fast, adapts widely, and has high benefits. It can be used for construction, shipbuilding, high-end furniture, etc.; it has strong budding power, dense branches and leaves, more shade tolerant, good mixed growth performance, can be planted in pure forest, can also be mixed afforestation, is a mixed afforestation of coniferous species It is one of the most ideal companion tree species for the species; Castanopsis hystrix has a strong ability to adapt to the habitat. It is located in the tree layer in the community. It is the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor蒋燚刘海龙朱积余黄荣林姜英何应会
OwnerGUANGXI FORESTRY RES INST