OSBPL2 mutant gene as well as identification method and detection kit thereof

A detection kit and identification method technology, which is applied in the field of hereditary non-syndromic deafness-related genes, its identification method and detection kit, can solve the problems of time-consuming and laborious, and achieve the effect of convenient method and cost reduction

Inactive Publication Date: 2014-04-30
NANJING MEDICAL UNIV +2
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the traditional method of mapping genes for monogenic hereditary diseases is used, it will be a time-consuming and laborious process because the linkage region will involve known genes, unknown genes and predicted genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • OSBPL2 mutant gene as well as identification method and detection kit thereof
  • OSBPL2 mutant gene as well as identification method and detection kit thereof
  • OSBPL2 mutant gene as well as identification method and detection kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Taking NSHL as an example, the inventor detected a new deafness-related gene (flow chart as shown in figure 1 shown), which includes the following steps:

[0057] 1) The inventor collected a 7-generation autosomal dominant NSHL pedigree, and the results of consultation and hearing tests showed that all patients in the pedigree showed late-onset, progressive moderate and severe non-syndromic deafness. The peripheral blood of the family members was collected and genomic DNA was extracted.

[0058] 2) Using human genome exon capture technology to perform exon capture and analysis on the whole genome DNA of 3 patients and 1 normal control in the family described in 1), and obtain the mutation sites of candidate hereditary deafness-related genes.

[0059] 3) Combining conventional sequencing methods to identify the mutation sites of candidate genetic deafness-related genes: a. Perform genetic co-segregation verification on the rest of the samples in the family that did not ...

Embodiment 2

[0061] Example 2: Sequencing the causative genes of this NSHL family using human genome exome capture

[0062] Subsequently, the inventors used Agilent SureSelect Human All Exon Kit (38M) combined with Solexa high-throughput sequencing technology to sequence the exome sequences of 3 patients and 1 normal person in the NSHL family described in Example 1, and successfully A new NSHL-associated gene, a mutant of the OSBPL2 gene, was discovered. The specific operation steps are as follows:

[0063] 1) Randomly break the genomic DNA into fragments of about 150-200bp, and then connect adapters to both ends of the fragments to prepare a hybrid library (see the Illumina / Solexa standard library construction instructions provided by http: / / www.illumina.com / ; Accurate whole human genome sequencing using reversible terminator chemistry. Nature 2008, 456:53-59).

[0064] 2) After purification, the library was subjected to linear amplification of Ligation-mediated PCR (LM-PCR) and hybridi...

Embodiment 3

[0094] Example 3: Further verification of the c.153del CT mutation site of the OSBPL2 gene

[0095] The inventor verified the c.153del CT mutation site of the OSBPL2 gene by combining conventional sequencing methods: ① Verify the genetic co-segregation of all samples in the family described in Example 1; ② Verify the exon and exon of the ① verified gene PCR amplification and detection of the sequence of the sub-intron junction region; ③ Expand the sample size (normal controls outside the family, small autosomal dominant families, sporadic deaf cases) verification.

[0096] 1) Amplify the mutation by PCR

[0097] Genomic DNA was prepared from the peripheral blood samples of all patients in the family according to the method in Example 1. After the concentration was adjusted to 25ng / μl, PCR reaction was carried out.

[0098] PCR primers were designed by Primer v5.0, and the sequences are as follows:

[0099] Upstream primer: CTGGATCTCACTCACATTCT (SEQ ID NO: 21)

[0100] Down...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an OSBPL2 mutant gene as well as an identification method and a detection kit thereof. The OSBPL2 mutant gene has the deletion of nucleotide C and T between 152-bit nucleotide C and 155-bit nucleotide C in an exon 3 region of a human OSBPL2 gene sequence, and / or 583-bit nucleotide C in an exon 7 region of the human OSBPL2 gene sequence, is mutated to nucleotide A. By adopting the OSBPL2 mutant gene as well as the identification method and the detection kit thereof, a pathogenic gene of a hereditary disease is discovered by utilizing a human genome exon trapping technology; the identification method is simple and convenient; in addition, as only one or a small quantity of gene mutation sample is needed to trap a human genome exon sequence, the cost is greatly lowered; gene identification has an important value to genetic diagnosis of NSHL (Non-Syndromic Hearing Loss) susceptible and occurrence populations and has an important significance of exploring NSHL pathogenesis and opening up a novel therapy approach.

Description

technical field [0001] The invention belongs to genetics and molecular biology, and specifically relates to an identification method of a genetic disease-causing gene, in particular to a genetic non-syndromic deafness-related gene, an identification method and a detection kit. Background technique [0002] Deafness is a relatively common human sensory system defect and a common disease that affects human health and causes disability. The etiology of deafness is complex, and genetic factors play an important role. More than 60% of congenital deafness is caused by genetic factors [1-2] . Studies have shown that more than 60 different types of gene variations distributed in the nucleus and mitochondria are involved in the occurrence of hereditary non-syndromic hearing loss (NSHL). These genes are mainly arranged on autosomes, and only a few Located in sex chromosomes and mitochondrial DNA, they present a typical single-gene inheritance and mitochondrial maternal inheritance i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/63C12Q1/68
Inventor曹新邢光前魏钦俊姚俊陈智斌鲁雅洁
OwnerNANJING MEDICAL UNIV