Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for constructing IL-33 presentation VLP (Virus-Like Particle) vaccine used in active immunotherapy of chronic asthma

A technology for active immunization and chronic asthma, applied in the field of medical biology, can solve problems such as inability to effectively treat asthma, and achieve the effects of strong immunogenicity and simple preparation

Active Publication Date: 2014-08-27
INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The technical problem to be solved by the present invention is to construct an effective virus-like particle vaccine that contains the whole molecule of IL-33 mature protein for the problem that existing technical means cannot effectively treat asthma. It can induce strong neutralizing antibodies against self-molecules with persistent effect to regulate the immune response, so as to achieve the purpose of regulating the disease process of asthma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing IL-33 presentation VLP (Virus-Like Particle) vaccine used in active immunotherapy of chronic asthma
  • Method for constructing IL-33 presentation VLP (Virus-Like Particle) vaccine used in active immunotherapy of chronic asthma
  • Method for constructing IL-33 presentation VLP (Virus-Like Particle) vaccine used in active immunotherapy of chronic asthma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0059] 1) Routine total RNA extraction from mouse lung tissue was performed with RNAiso Plus; and the obtained total RNA was reverse-transcribed into total cDNA by conventional reverse transcription with a reverse transcription kit; the obtained total cDNA was obtained by PCR with designed specific primers Amplified to obtain the mature fragment gene encoding IL-33, the specific primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., as follows:

[0060] Upstream primer (5' end) of the gene encoding the mature fragment of IL-33: gtggatccagcatccaaggaacttcac

[0061] Downstream primer (3' end) of the gene encoding the mature fragment of IL-33: gtgaattcgattttcgagagcttaaac

[0062] And in the following PCR system (20 microliters): 5' end primer: 0.2 microliters, 3' end primer: 0.2 microliters, 10X PCR buffer: 2 microliters, dNTP: 1.6 microliters, Taq enzyme: 0.2 microliters , cDNA template: 1 microliter, double distilled water: 14.8 microliters, perform the follow...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
antibody titeraaaaaaaaaa
Login to View More

Abstract

The invention provides a method for constructing an IL-33 presentation VLP (Virus-Like Particle) vaccine used in active immunotherapy of chronic asthma. The method comprises the following steps: extracting IL-33 total RNA (Ribonucleic Acid) from a mouse; performing reverse transcription to obtain IL33 total cDNA (complementary deoxyribonucleic acid); performing PCR (Polymerase Chain Reaction) amplification on the obtained total cDNA with a designed specific primer to obtain a coded IL-33 mature segment gene; inserting the gene between 78-bit amino acid and 79-bit amino acid of a hepatitis B virus core antigen HBcAg to obtain a recombinant plasmid pHBcAg33; transferring the plasmid onto escherichia coli DH5alpha or a BL21 competent cell; inducing by using IPTG (isopropyl-beta-d-thiogalactoside) and purifying to obtain the IL-33 presentation VLP vaccine. A strong neutralizing antibody which is specific to own molecules and has a durable action can be induced by inoculating the vaccine repeatedly in order to regulate and control immune response, thereby fulfilling the aim of regulating and controlling the progress of asthma.

Description

[0001] technical field [0002] The invention relates to a preparation method of an anti-cytokine virus-like particle vaccine—IL-33 virus-like particle vaccine, and its therapeutic use in asthma, belonging to the field of medical biotechnology. Background technique [0003] Interleukin-33 (IL-33 for short) is a new cytokine discovered by bioinformatics technology in 2005, which belongs to the IL-1 family member. Abundantly expressed in human smooth muscle cells and bronchial epithelial cells as well as dendritic cells. The main function is to promote Th2-type immune response, and its function is that IL-33 has a strong function of stimulating Th2 differentiation and activation. By stimulating the expression of Th2 cytokines, IL-33 can promote the synthesis of IgE by B cells, promote the recruitment, maturation and survival of mast cells, and stimulate the survival and effector functions of eosinophils and basophils. [0004] Asthma is a serious airway inflammatory disease,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/385A61K38/20A61K47/42A61P11/06
Inventor 马雁冰龙琼黄惟巍姚宇峰杨旭孙文佳金晓媚李杨褚晓杰刘存宝
Owner INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More