Method for constructing IL-33 presentation VLP (Virus-Like Particle) vaccine used in active immunotherapy of chronic asthma
A technology for active immunization and chronic asthma, applied in the field of medical biology, can solve problems such as inability to effectively treat asthma, and achieve the effects of strong immunogenicity and simple preparation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0059] 1) Routine total RNA extraction from mouse lung tissue was performed with RNAiso Plus; and the obtained total RNA was reverse-transcribed into total cDNA by conventional reverse transcription with a reverse transcription kit; the obtained total cDNA was obtained by PCR with designed specific primers Amplified to obtain the mature fragment gene encoding IL-33, the specific primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., as follows:
[0060] Upstream primer (5' end) of the gene encoding the mature fragment of IL-33: gtggatccagcatccaaggaacttcac
[0061] Downstream primer (3' end) of the gene encoding the mature fragment of IL-33: gtgaattcgattttcgagagcttaaac
[0062] And in the following PCR system (20 microliters): 5' end primer: 0.2 microliters, 3' end primer: 0.2 microliters, 10X PCR buffer: 2 microliters, dNTP: 1.6 microliters, Taq enzyme: 0.2 microliters , cDNA template: 1 microliter, double distilled water: 14.8 microliters, perform the follow...
PUM
Property | Measurement | Unit |
---|---|---|
antibody titer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com