Application of OsVTC1-1 in improvement of plant salt stress tolerance
A plant salt and plant technology, applied in the fields of application, plant peptides, plant gene improvement, etc., can solve the problems of unclear Vc, etc., and achieve the effects of improving stress tolerance, increasing salt stress tolerance, and improving nutritional value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1, OsVTC1-1 Transformation of Arabidopsis thaliana with gene overexpression vector
[0039] 1. Interfering with the construction of expression vectors
[0040] (1) Genomic DNA of rice Zhonghua 17 was extracted.
[0041] (2) Design and synthesize the following primers:
[0042] Upstream primer: 5'-GC TCTAGA ACCATGAAGGCGCTCATT-3' (SEQ ID NO. 4)
[0043] Downstream primer: 5'-CAGTCGACCATGACAATCTCAGGCTT-3' (SEQ ID NO.5)
[0044] (The underlined sequence is the enzyme recognition site)
[0045] (3) Using the genomic DNA in step (1) as a template, and using the upstream primer and downstream primer in step (2) as primers to perform PCR amplification to obtain OsVTC1-1 Gene.
[0046] (4) use Xba I and Sal 1. The PCR product obtained in step (3) of double digestion to obtain gene fragments; Xba I and Sal I double digested pCAMBIA1307 to obtain a large carrier fragment; the gene fragment was connected to the large carrier fragment to obtain a r...
Embodiment 2
[0059] Embodiment 2, OsVTC1-1 Transformation of Rice with Gene Interference Vectors
[0060] 1. Construction of overexpression vector
[0061] (1) Genomic DNA of rice Zhonghua 17 was extracted.
[0062] (2) Design and synthesize the following primers:
[0063] Upstream primer: 5'-CT CTCGAG CCTCCTTTTATGTTATGGTA-3 (SEQ ID NO. 6)
[0064] Downstream primer: 5'-CC AGATCT AAGAACAAAGTACAAGGCTG-3' (SEQ ID NO. 7)
[0065] (The underlined sequence is the enzyme recognition site)
[0066] (3) Perform PCR amplification using the genomic DNA in step (1) as a template, and the upstream primer and downstream primer in step (2) as primers to obtain a PCR amplification product. The nucleotide sequence of the DNA molecule is as shown in SEQ ID No. .3 shown. (ACCESSION NUMBER is NM_001051330; sequence is
[0067] cctccttttatgttatggtatactcaagttcttttaatgcagtatctttagtttatacctgtgatccttccaagatgttgacctagcatgtgtgttactcacattctgaaaactgcttctcaatgagaattcagtgtgccatatttgattgtaccttcatttggaccatc...
Embodiment 3
[0082] Example 3, Vitamin C Content Detection in Transgenic Plants
[0083] 1. Select the roots of 3-week-old T3 generation transgenic rice and wild-type rice Zhonghua 17, and transgenic Arabidopsis, wild-type Arabidopsis and Arabidopsis VTC1 mutant vtc1-1 The leaves were rinsed with water, and the excess water was blotted with absorbent paper, then quickly frozen with liquid nitrogen and stored at -80°C.
[0084] 2. Accurately weigh 0.175g of AsA, dissolve it in 1ml of perchloric acid (HClO) with a volume percentage of 6%. 4 ) in an aqueous solution to obtain a 1 mmol / ml AsA solution.
[0085] 3. Dilute the 1mmol / ml AsA solution with 6% perchloric acid solution to a final concentration of 1000nmol / ml, 800nmol / ml, 600nmol / ml, 400nmol / ml, 200nmol / ml, 100nmol / ml AsA solution.
[0086] 4. Take 300 μl of AsA solutions of different concentrations obtained in step 3, add 2700 μl of pH=12.7 sodium succinate buffer, and mix well. At this time, the pH is about 5.8, and the c...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap