Application of OsVTC1-1 in improvement of plant salt stress tolerance

A plant salt and plant technology, applied in the fields of application, plant peptides, plant gene improvement, etc., can solve the problems of unclear Vc, etc., and achieve the effects of improving stress tolerance, increasing salt stress tolerance, and improving nutritional value

Inactive Publication Date: 2014-08-27
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, although the functions of key enzyme genes in the Vc synthesis pathway in the model plant Arabidopsis are relatively clear, the Vc synthesis pathway in food crops such as rice is still unclear.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsVTC1-1 in improvement of plant salt stress tolerance
  • Application of OsVTC1-1 in improvement of plant salt stress tolerance
  • Application of OsVTC1-1 in improvement of plant salt stress tolerance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1, OsVTC1-1 Transformation of Arabidopsis thaliana with gene overexpression vector

[0039] 1. Interfering with the construction of expression vectors

[0040] (1) Genomic DNA of rice Zhonghua 17 was extracted.

[0041] (2) Design and synthesize the following primers:

[0042] Upstream primer: 5'-GC TCTAGA ACCATGAAGGCGCTCATT-3' (SEQ ID NO. 4)

[0043] Downstream primer: 5'-CAGTCGACCATGACAATCTCAGGCTT-3' (SEQ ID NO.5)

[0044] (The underlined sequence is the enzyme recognition site)

[0045] (3) Using the genomic DNA in step (1) as a template, and using the upstream primer and downstream primer in step (2) as primers to perform PCR amplification to obtain OsVTC1-1 Gene.

[0046] (4) use Xba I and Sal 1. The PCR product obtained in step (3) of double digestion to obtain gene fragments; Xba I and Sal I double digested pCAMBIA1307 to obtain a large carrier fragment; the gene fragment was connected to the large carrier fragment to obtain a r...

Embodiment 2

[0059] Embodiment 2, OsVTC1-1 Transformation of Rice with Gene Interference Vectors

[0060] 1. Construction of overexpression vector

[0061] (1) Genomic DNA of rice Zhonghua 17 was extracted.

[0062] (2) Design and synthesize the following primers:

[0063] Upstream primer: 5'-CT CTCGAG CCTCCTTTTATGTTATGGTA-3 (SEQ ID NO. 6)

[0064] Downstream primer: 5'-CC AGATCT AAGAACAAAGTACAAGGCTG-3' (SEQ ID NO. 7)

[0065] (The underlined sequence is the enzyme recognition site)

[0066] (3) Perform PCR amplification using the genomic DNA in step (1) as a template, and the upstream primer and downstream primer in step (2) as primers to obtain a PCR amplification product. The nucleotide sequence of the DNA molecule is as shown in SEQ ID No. .3 shown. (ACCESSION NUMBER is NM_001051330; sequence is

[0067] cctccttttatgttatggtatactcaagttcttttaatgcagtatctttagtttatacctgtgatccttccaagatgttgacctagcatgtgtgttactcacattctgaaaactgcttctcaatgagaattcagtgtgccatatttgattgtaccttcatttggaccatc...

Embodiment 3

[0082] Example 3, Vitamin C Content Detection in Transgenic Plants

[0083] 1. Select the roots of 3-week-old T3 generation transgenic rice and wild-type rice Zhonghua 17, and transgenic Arabidopsis, wild-type Arabidopsis and Arabidopsis VTC1 mutant vtc1-1 The leaves were rinsed with water, and the excess water was blotted with absorbent paper, then quickly frozen with liquid nitrogen and stored at -80°C.

[0084] 2. Accurately weigh 0.175g of AsA, dissolve it in 1ml of perchloric acid (HClO) with a volume percentage of 6%. 4 ) in an aqueous solution to obtain a 1 mmol / ml AsA solution.

[0085] 3. Dilute the 1mmol / ml AsA solution with 6% perchloric acid solution to a final concentration of 1000nmol / ml, 800nmol / ml, 600nmol / ml, 400nmol / ml, 200nmol / ml, 100nmol / ml AsA solution.

[0086] 4. Take 300 μl of AsA solutions of different concentrations obtained in step 3, add 2700 μl of pH=12.7 sodium succinate buffer, and mix well. At this time, the pH is about 5.8, and the c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of OsVTC1-1 protein in the improvement of plant vitamin C synthesis. In vitro, the OsVTC1-1 protein can catalyze mannose-1-mannose to generate GDP-mannose, and it shows that the OsVTC1-1 protein has GDP-mannose pyrophosphorylase activity, may participate in the galactose path in vivo so as to regulate and control synthesis of the Vc, and can improve the plant salt stress tolerance. The OsVTC1-1 can increase the Vc content in the mutant ctc1-1 of Arabidopsis VTC1, and therefore the salt tolerance of transgentic plants is increased. In addition, expression of the OsVTC1-1 in rice is interfered with so that synthesis of the rice Vc can be obviously restrained, and therefore the salt stress tolerance of rice is reduced. It can be seen that the OsVTC1-1 protein has an important effect on improving the plant salt stress tolerance.

Description

technical field [0001] The invention relates to an application of OsVTC1-1 protein in improving plant salt stress tolerance. Background technique [0002] Vitamin C is an important antioxidant and coenzyme in animals and plants. It can remove reactive oxygen species (ROS) accumulated in plants under normal physiological activities and stress conditions. In the stress response of plants, it can increase the ROS accumulated in plants. Plant stress tolerance plays an important role, so increasing the vitamin C content in plants through biotechnology plays an important role in improving crop stress tolerance. [0003] Studies have shown that the L-galactose pathway is the main pathway for plant vitamin C biosynthesis, and its activity is closely related to the vitamin C content in plants. The synthesis pathway of galactose pathway uses fructose phosphate as the initial substrate, fructose phosphate generates 6-phosphate mannose under the action of mannose-6-phosphate isomerase,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82
CPCC12N9/1241C12N15/8273C12Y207/07022
Inventor张执金秦华邓载安张传玉王亚云王娟张海文权瑞党黄荣峰
OwnerTHE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI