Method for expressing and purifying human cytoplasmic gelsolin
A gelsolin, expression and purification technology, applied in the direction of animal/human peptides, the use of vectors to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of low expression of cytoplasmic gelsolin and difficult purification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] The primers for amplifying human cytoplasmic gelsolin hcGSN gene were synthesized, and the primers were designed as follows:
[0023] Upstream primer FW (hcGSN): 5'- CAGGCCTCGAGGTGGTGGAACACCCCCGAGTTCCTC -3';
[0024] Downstream primer RV (hcGSN): 5'-CACGCCTCGAGCTAGGCAGCCAGCTCAGCCATGG-3';
[0025] Restriction endonuclease introduced in both upstream and downstream primers xho The single enzyme cutting site of I.
Embodiment 2
[0027] This example illustrates the construction of pET-15b-hcGSN recombinant expression vector.
[0028] Using human plasma gelsolin cDNA (GenBank: X04412.1) as a template, using the upstream primer FW (hcGSN) and downstream primer RV (hcGSN) in Example 1, the hcGSN gene was amplified by PCR. The specific PCR program is as follows: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 1 minute, annealing at 64°C for 1 minute, extension at 72°C for 2 minutes, the total number of cycles is 25; and finally extension at 72°C for 10 minutes. The PCR product and the prokaryotic expression vector pET15b were respectively digested with restriction endonuclease XhoI. The digested products were subjected to 1% agarose gel electrophoresis, and the corresponding DNA fragments were recovered with a gel recovery kit. T4 DNA ligase was used for overnight ligation at 16°C, and the ligation product was transformed into Escherichia coli DH5α competent cells and cultured at 37°C. S...
Embodiment 3
[0030] This example illustrates the expression of hcGSN recombinant protein.
[0031] The pET-15b-hcGSN recombinant expression plasmid constructed in Example 2 was transformed into Escherichia coli BL21 (DE3) competent cells to obtain an engineering strain containing the recombinant plasmid. A single colony of the engineered strain was picked, inoculated in LB liquid medium, and cultured overnight at 37°C. The next day, transfer to fresh LB medium according to 1% inoculum volume, and shake culture at 37°C until OD 600nm After reaching 0.6-0.8, add IPTG with a final concentration of 0.4 for induction for 4 hours. At the same time, the bacterial solution induced without IPTG was set as a control. Then the bacterial liquid was collected and centrifuged at 5000rpm to obtain bacterial pellet. Add SDS-PAGE gel electrophoresis loading buffer 50mM Tris-HCl (containing 2% SDS, 0.1% bromophenol blue, 10% glycerol, 50 mM NaCl, 0.5 mM PMSF, 100mM DTT, pH 6.8) to the pellet, Lyse E. co...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com