Method for expressing and purifying human cytoplasmic gelsolin

A gelsolin, expression and purification technology, applied in the direction of animal/human peptides, the use of vectors to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of low expression of cytoplasmic gelsolin and difficult purification

Inactive Publication Date: 2014-08-27
NANJING UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a method for the expression and purification of human cytoplasmic gelsolin, which solves the problems of low cytoplasmic gelsolin expression and difficult purification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing and purifying human cytoplasmic gelsolin
  • Method for expressing and purifying human cytoplasmic gelsolin
  • Method for expressing and purifying human cytoplasmic gelsolin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] The primers for amplifying human cytoplasmic gelsolin hcGSN gene were synthesized, and the primers were designed as follows:

[0023] Upstream primer FW (hcGSN): 5'- CAGGCCTCGAGGTGGTGGAACACCCCCGAGTTCCTC -3';

[0024] Downstream primer RV (hcGSN): 5'-CACGCCTCGAGCTAGGCAGCCAGCTCAGCCATGG-3';

[0025] Restriction endonuclease introduced in both upstream and downstream primers xho The single enzyme cutting site of I.

Embodiment 2

[0027] This example illustrates the construction of pET-15b-hcGSN recombinant expression vector.

[0028] Using human plasma gelsolin cDNA (GenBank: X04412.1) as a template, using the upstream primer FW (hcGSN) and downstream primer RV (hcGSN) in Example 1, the hcGSN gene was amplified by PCR. The specific PCR program is as follows: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 1 minute, annealing at 64°C for 1 minute, extension at 72°C for 2 minutes, the total number of cycles is 25; and finally extension at 72°C for 10 minutes. The PCR product and the prokaryotic expression vector pET15b were respectively digested with restriction endonuclease XhoI. The digested products were subjected to 1% agarose gel electrophoresis, and the corresponding DNA fragments were recovered with a gel recovery kit. T4 DNA ligase was used for overnight ligation at 16°C, and the ligation product was transformed into Escherichia coli DH5α competent cells and cultured at 37°C. S...

Embodiment 3

[0030] This example illustrates the expression of hcGSN recombinant protein.

[0031] The pET-15b-hcGSN recombinant expression plasmid constructed in Example 2 was transformed into Escherichia coli BL21 (DE3) competent cells to obtain an engineering strain containing the recombinant plasmid. A single colony of the engineered strain was picked, inoculated in LB liquid medium, and cultured overnight at 37°C. The next day, transfer to fresh LB medium according to 1% inoculum volume, and shake culture at 37°C until OD 600nm After reaching 0.6-0.8, add IPTG with a final concentration of 0.4 for induction for 4 hours. At the same time, the bacterial solution induced without IPTG was set as a control. Then the bacterial liquid was collected and centrifuged at 5000rpm to obtain bacterial pellet. Add SDS-PAGE gel electrophoresis loading buffer 50mM Tris-HCl (containing 2% SDS, 0.1% bromophenol blue, 10% glycerol, 50 mM NaCl, 0.5 mM PMSF, 100mM DTT, pH 6.8) to the pellet, Lyse E. co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for expressing and purifying human cytoplasmic gelsolin (hcGSN). A recombinant expression vector pET-15b-hcGSN is constructed by designing a primer, IPTG inducible expression is used for obtaining N-end recombinant objective protein hcGSN with His labels, and recombinant protein hcGSN with high purity can be obtained through nickel ion affinity chromatography one-step purification. According to the method for expressing and purifying the hcGSN, cleavage sites of thrombin are further designed between the His labels and amino acid sequences of the hcGSN, and the His labels can be removed through the thrombin as needed. The method for producing and recombining the hcGSN is provided, massive soluble expression of the hcGSN in Escherichia coli is achieved, and the recombinant hcGSN with high purity can be efficiently, easily, conveniently and stably obtained through nickel ion affinity chromatography purification. The recombinant protein provides a material basis for related scientific researches and is possibly applied to prevention and treatment of diseases such as tumors and Alzheimer diseases in future.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a method for expressing and purifying human cytoplasmic gelsolin (hcGSN for short), including the construction of engineering bacteria, expression and purification of recombinant human cytoplasmic gelsolin. Background technique [0002] Gelsolin is ubiquitously present in cells, blood and cerebrospinal fluid and is a multifunctional actin-binding protein. The classic function of gelsolin is to regulate actin filament polymerization, depolymerization and shearing, thus playing an important role in processes such as cytoskeletal structure rearrangement and cell motility. The same gelsolin gene produces two forms of gelsolin, including cytoplasmic gelsolin and plasma gelsolin, due to different splicing patterns of exons. Plasma gelsolin has 25 more amino acid residues at the N-terminus than cytoplasmic gelsolin, and the rest of the amino acid sequence is identical. A la...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C07K14/47C07K1/22
Inventor吉丽娜华子春赵熙
OwnerNANJING UNIV