Check patentability & draft patents in minutes with Patsnap Eureka AI!

PCR (Polymerase Chain Reaction) primer, PCR primer group, PCR detection probe and PCR detection kit for detecting hepatitis B virus as well as detection method

A hepatitis B virus detection kit technology, applied in biochemical equipment and methods, microorganism-based methods, microorganisms, etc., can solve the problems of expensive equipment, poor sensitivity, and high detection costs, achieve wide clinical application, prevent false Negative, contamination-avoiding effect

Active Publication Date: 2015-07-15
GUANGZHOU SUPBIO BIO TECH & SCI
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, most hospitals in China generally use domestic fluorescent quantitative PCR reagents to detect serum HBV DNA load, which are cheap, but the sensitivity is poor, and the lower limit of detection is generally 100 IU / ml, for HBV DNA loads below this lower limit, no further distinction can be made, and for higher HBV DNA loads, the detection accuracy is poor, and the detection values ​​are often lower than the actual level
At present, the imported reagents used in China mainly include Roche’s COBAS amplicor and COBAS Taqman, among which COBAS Taqman HBV DNA is the only automatic control technology for test tube diagnosis using Taqman technology approved by the US FDA, and is included in the clinical practice guidelines for chronic hepatitis B. The recommended HBV DNA detection method has the advantages of high sensitivity, wide linear range, real-time monitoring, and good repeatability. The detection range can reach 20 IU / mL~1.7×108 IU / mL. Its equipment is expensive and the detection cost is high, so it is difficult to be widely used in clinical practice.
Moreover, HBV DNA levels at the time of discontinuation may be below the detection limit of Roche's reagent of 20 IU / mL

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR (Polymerase Chain Reaction) primer, PCR primer group, PCR detection probe and PCR detection kit for detecting hepatitis B virus as well as detection method
  • PCR (Polymerase Chain Reaction) primer, PCR primer group, PCR detection probe and PCR detection kit for detecting hepatitis B virus as well as detection method
  • PCR (Polymerase Chain Reaction) primer, PCR primer group, PCR detection probe and PCR detection kit for detecting hepatitis B virus as well as detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Embodiment 1: detect the PCR primer set of hepatitis B virus

[0083] In the early stage of the present invention, through a variety of computer programs and primer design principles combined with our actual experience, a large number of PCR primers for detecting hepatitis B virus were designed. About 80, and then through a large number of experimental studies to screen out highly sensitive and highly specific primer sequences and detection probes, and finally select the best PCR primer set for detecting hepatitis B virus effect, which includes 2 groups, and its nucleotide sequences are respectively as follows:

[0084] Primer set 1:

[0085] SEQ ID NO: 1 GGCAACGGCCTGGTCTGTGCCAAGTGT,

[0086] SEQ ID NO: 2 GGCAACGGTCAGGTCTCTGCCAAGTGT,

[0087] SEQ ID NO: 3: TGACGCAACCCCCACTG,

[0088] SEQ ID NO: 4: GCTGCGAGCAAAACAAG,

[0089] SEQ ID NO: 5: GCGCAGGATCCAGTTGGCAGCACA,

[0090] SEQ ID NO: 6: GTCCCGCGCAGGATCCAGTTGGCAGC,

[0091] Or the nucleotide complementary sequenc...

Embodiment 2

[0100] Embodiment 2: detect the PCR detection kit of hepatitis B virus

[0101] The PCR test kit for detection of hepatitis B virus includes the following components:

[0102] 1) Containing at least one set of primer sets in the set of primers described in Example 1;

[0103] 2) Detection probe: the detection probe is selected from at least one of the following probe sequences:

[0104] SEQ ID NO: 13: CCGATCCATACTGCGGAACT

[0105] SEQ ID NO: 14: CCGATCCATACTGCGGAAC

[0106] SEQ ID NO: 15: GCCGATCCATACTGCGGAACT

[0107] SEQ ID NO: 16: GCCGATCCATACTGCGGAAC;

[0108] Or the nucleotide complementary sequence of these sequences;

[0109] The fluorescent group labeled at the 5' end of the probe sequence is any one of FAM, HEX, VIC, CY5, and TET, and the quenching group labeled at the 3' end of the probe sequence is any one of TAMRA, MGB, and BHQ.

[0110] 3) The sequences of the internal control primer set and internal control probe are:

[0111] The sequence of the inter...

Embodiment 3

[0122] Embodiment 3: detect the PCR detection method of hepatitis B virus

[0123] Utilize the detection kit established in Example 2 to detect the sample to be detected, the steps are as follows:

[0124] 1) DNA extraction:

[0125] Take 200ul each of the sample to be tested, negative quality control, critical positive quality control, strong positive quality control, and positive quantitative reference, add 0.5ul of internal standard and 200ul of DNA concentrate, shake and mix for 10s, centrifuge at 12000rpm for 10min . Discard the supernatant, add 20ul of DNA lysate, shake and mix for 30s, and incubate at 100±5°C for 10min. Centrifuge at 12000rpm for 5min; take the supernatant separately to obtain the template DNA of each sample;

[0126] 2) PCR reaction system:

[0127] PCR reaction solution 43.2μl

[0128] 5U / ul Taq Enzyme 0.8μl

[0129] 1U / ul UNGase 0.06μl

[0130] DNA template 6 μl.

[0131] 3) The PCR reaction program is (taking ABI7500 as an example): ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PCR (Polymerase Chain Reaction) primer, a PCR primer group, a PCR detection probe and a PCR detection kit for detecting hepatitis B virus as well as a detection method. The kit contains the high-sensitivity detection primer group and the high-sensitivity detection probe and can be used for detecting single copy HBVDNA (Hepatitis B virus-Deoxyribonucleic acid), the limit of detection of the kit in a serum specimen can reach 2IU / mL, and compared with an imported reagent Roche COBAS, the kit is relatively sensitive. The detection method disclosed by the invention can be used for detecting different subtypes of hepatitis B pathogens around the world; due to addition of an internal control system in the detection method, false negative can be effectively prevented; due to addition of a UNG (uracil-N-glycosylase) system in the detection method, pollution can be effectively avoided; the kit and the detection method have the beneficial effects that the kit and the detection method can be applied to diagnosis of hepatitis B, evaluation of research, development and screening of anti-hepatitis-B new drugs and evaluation of an anti-hepatitis-B treatment effect and relapsing and have wide clinical application effects, and the popularization and application of the kit and the detection method are facilitated.

Description

technical field [0001] The invention belongs to the field of virus detection, and relates to a PCR primer, a primer set, a probe, a kit thereof and a detection method for detecting hepatitis B virus. Background technique [0002] Hepatitis B virus (HBV) infection is distributed globally, with more than two billion infected people, and it is one of the most serious infectious diseases in my country. According to the national epidemiological survey of hepatitis B carried out in 2010, there are still about 93 million hepatitis B surface antigen carriers in my country, and hepatitis B and liver cancer patients account for about a quarter of the world. Chronic HBV infection is the main cause of chronic hepatitis, liver cirrhosis, liver failure and primary liver cancer, and causes more than 1 million deaths every year, causing great social and economic harm. [0003] HBV replication is the root cause of chronic HBV activity. Effective antiviral therapy can delay the progression o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/6848C12Q1/686C12Q1/70C12Q2531/113C12Q2521/531
Inventor 朱托夫
Owner GUANGZHOU SUPBIO BIO TECH & SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More