Indirect ELISA method and kit for detecting serum 3-type duck hepatitis virus a antibody
A technology of duck hepatitis A and reagent kit, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems of unstable results, laborious, and time-consuming neutralization tests, and achieve good specificity, good stability, and sensitivity high effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Expression and Purification of Coating Antigen VP1 Protein
[0032] (1) Amplification and purification of target fragments
[0033] A commercial RNA extraction kit (MiniBEST Universal RNA Extraction Kit, TaKaRa) was used, and the specific operation was detailed in the instruction manual to extract serum type 3 duck hepatitis A virus RNA and reverse transcribe to prepare template cDNA.
[0034] The reverse transcription system is: RNA 4.0 μL, random primer (20 μM), Oligod (T) (20 μM) 0.5 μL each, dNTPs (2.5 μM) 4.0 μL, Rnase Inhibitor 0.5 μL, reverse transcriptase M-MLV (TaKaRa) 0.5μL, 5×M-MLV Buffer 4.0μL.
[0035] After the reaction system was mixed evenly, it was centrifuged. The reaction conditions are: keep warm at 42°C for 1 hour, and act at 70°C for 10 minutes.
[0036] The cDNA obtained by reverse transcription was used as a template to amplify the VP1 gene, and the amplification primers were:
[0037] DHAV-3 VP1FP:GA GAATTC GGTGATTCCAATCAGCTTGGTG,...
Embodiment 2
[0044] Example 2 The preparation method of the indirect ELISA kit of serum type 3 duck hepatitis A virus antibody
[0045] (1) Coat the VP1 protein antigen evenly on the wells of the microtiter plate, and the coating buffer is phosphate buffered saline (PBS, 0.01M pH7.2), that is, 1 liter of solution contains 8.0g of NaCl and 0.2g of KCl , Na 2 HPO 4 12H 2 O 3.6g, KH 2 PO 4 0.24g, the amount of VP1 protein coating is 0.1-1μg per well; the blocking solution is BSA or skim milk, the concentration is 1%-10%.
[0046] (2) HRP-mouse anti-duck IgY enzyme-labeled secondary antibody is a commercial reagent, diluted to 0.2-2 μg / mL with PBS containing 1% BSA.
[0047] (3) Preparation of other solutions in the kit: ① Sample diluent: 1% BSA, 0.05% NaN 3 , PBS (0.01M, pH 7.2). ②10× washing solution: add Tween-20 (Tween-20) to 0.1mol / L PBS solution, so that the concentration of Tween-20 is 0.5% (V / V). ③The enzyme substrate is 3,3',5,5'-tetramethylbenzidine (TMB) solution: i) Substr...
Embodiment 3
[0048] Example 3 The operation method of the indirect ELISA kit of serum type 3 duck hepatitis A virus antibody
[0049] (1) Dilute the sample to be tested 100 times with sample diluent, add 100 μL to each well, add positive and negative control solutions at the same time, and set a blank control. Three wells were loaded in parallel for each sample and control. Incubate at 37°C for 1 hour, wash the plate 5 times with the washing solution, pat dry, add 100 μL of HRP-mouse anti-duck IgY enzyme-labeled secondary antibody to each well, and incubate at 37°C for 1 hour; wash the plate 5 times with the washing solution, and pat dry; TMB substrate solution A and B were mixed in equal volumes, then added substrate for color development, 100 μL per well, kept away from light for 10 minutes, and added stop solution, 50 μL per well. The absorbance value (OD) was measured at 450 nm using a microplate reader 450nm value).
[0050] (2) Result judgment: Cut off (CO value) = negative contro...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com