Unlock instant, AI-driven research and patent intelligence for your innovation.

Indirect ELISA method and kit for detecting serum 3-type duck hepatitis virus a antibody

A technology of duck hepatitis A and reagent kit, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems of unstable results, laborious, and time-consuming neutralization tests, and achieve good specificity, good stability, and sensitivity high effect

Active Publication Date: 2014-12-17
WUHAN CHOPPER BIOLOGY
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, serotype 1 and serotype 3 duck hepatitis A viruses are mainly prevalent in clinical practice, but because duck hepatitis A virus 1 was discovered earlier, the relevant detection methods are relatively complete, and biological products such as live vaccines and egg yolk antibodies The application of Duck Hepatitis A Virus has played an active and effective role in the prevention and control of duck viral hepatitis caused by Type 1 Duck Hepatitis A Virus, while Serum Type 3 Duck Hepatitis A Virus was gradually discovered and reported after 2000, and with the increase of serum The widespread use of type 1 duck hepatitis A vaccine and egg yolk antibody, this immune pressure leads to the epidemic expansion trend of serotype 3 duck hepatitis A infection
At present, the detection of type 3 duck hepatitis A virus antibody mainly relies on the traditional neutralization test method. The neutralization test is time-consuming and laborious. The test results are greatly affected by the quality of the embryo source and the subjective judgment of the operating population, and the results are unstable.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Indirect ELISA method and kit for detecting serum 3-type duck hepatitis virus a antibody
  • Indirect ELISA method and kit for detecting serum 3-type duck hepatitis virus a antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Expression and Purification of Coating Antigen VP1 Protein

[0032] (1) Amplification and purification of target fragments

[0033] A commercial RNA extraction kit (MiniBEST Universal RNA Extraction Kit, TaKaRa) was used, and the specific operation was detailed in the instruction manual to extract serum type 3 duck hepatitis A virus RNA and reverse transcribe to prepare template cDNA.

[0034] The reverse transcription system is: RNA 4.0 μL, random primer (20 μM), Oligod (T) (20 μM) 0.5 μL each, dNTPs (2.5 μM) 4.0 μL, Rnase Inhibitor 0.5 μL, reverse transcriptase M-MLV (TaKaRa) 0.5μL, 5×M-MLV Buffer 4.0μL.

[0035] After the reaction system was mixed evenly, it was centrifuged. The reaction conditions are: keep warm at 42°C for 1 hour, and act at 70°C for 10 minutes.

[0036] The cDNA obtained by reverse transcription was used as a template to amplify the VP1 gene, and the amplification primers were:

[0037] DHAV-3 VP1FP:GA GAATTC GGTGATTCCAATCAGCTTGGTG,...

Embodiment 2

[0044] Example 2 The preparation method of the indirect ELISA kit of serum type 3 duck hepatitis A virus antibody

[0045] (1) Coat the VP1 protein antigen evenly on the wells of the microtiter plate, and the coating buffer is phosphate buffered saline (PBS, 0.01M pH7.2), that is, 1 liter of solution contains 8.0g of NaCl and 0.2g of KCl , Na 2 HPO 4 12H 2 O 3.6g, KH 2 PO 4 0.24g, the amount of VP1 protein coating is 0.1-1μg per well; the blocking solution is BSA or skim milk, the concentration is 1%-10%.

[0046] (2) HRP-mouse anti-duck IgY enzyme-labeled secondary antibody is a commercial reagent, diluted to 0.2-2 μg / mL with PBS containing 1% BSA.

[0047] (3) Preparation of other solutions in the kit: ① Sample diluent: 1% BSA, 0.05% NaN 3 , PBS (0.01M, pH 7.2). ②10× washing solution: add Tween-20 (Tween-20) to 0.1mol / L PBS solution, so that the concentration of Tween-20 is 0.5% (V / V). ③The enzyme substrate is 3,3',5,5'-tetramethylbenzidine (TMB) solution: i) Substr...

Embodiment 3

[0048] Example 3 The operation method of the indirect ELISA kit of serum type 3 duck hepatitis A virus antibody

[0049] (1) Dilute the sample to be tested 100 times with sample diluent, add 100 μL to each well, add positive and negative control solutions at the same time, and set a blank control. Three wells were loaded in parallel for each sample and control. Incubate at 37°C for 1 hour, wash the plate 5 times with the washing solution, pat dry, add 100 μL of HRP-mouse anti-duck IgY enzyme-labeled secondary antibody to each well, and incubate at 37°C for 1 hour; wash the plate 5 times with the washing solution, and pat dry; TMB substrate solution A and B were mixed in equal volumes, then added substrate for color development, 100 μL per well, kept away from light for 10 minutes, and added stop solution, 50 μL per well. The absorbance value (OD) was measured at 450 nm using a microplate reader 450nm value).

[0050] (2) Result judgment: Cut off (CO value) = negative contro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an indirect ELISA method and kit for detecting serum 3-type duck hepatitis virus a antibody and belongs to the technical field of serum antibody detection. The indirect ELISA method includes that serum 3-type duck hepatitis virus VP1 protein is utilized as an envelope antigen with the peridium quantity as 0.1-1mug per hole, HRP-mice anti-duck IgY is utilized as the HRP with the use concentration as 0.2-2mug / mL, and the coloration time is 10 minutes. The kit comprises a VP1 protein antigen envelope board, the HRP-mice anti-duck IgY, sample diluent, a scrubbing solution, TMB solutions A and B and a stop solution. The method and the kit can be used for detecting the serum 3-type duck hepatitis virus a antibody in duck serum and duck egg yolk, and the serum does not have cross reaction with positive serum of other viruses. Compared with a traditional neutral reaction detection method, the method has the advantage of being convenient and accurate.

Description

[0001] technical field [0002] The invention belongs to the technical field of serum antibody detection, and relates to an indirect ELISA method and a kit for detecting serum type 3 duck hepatitis A virus antibody. Background technique [0003] Duck hepatitis A virus (DHAV) is the main pathogen that causes duck viral hepatitis. It is prevalent all over the world and causes huge economic losses to the duck farming industry. According to the analysis of gene evolution, DHAV is divided into 3 different genotypes, genotype A, B, and C. Since there is no serological cross-reaction between each genotype, it can also be called 3 different serotypes , serotypes 1, 2 and 3. [0004] It should be noted that serotype 2 and 3 duck hepatitis A virus are not the traditional type 2 duck hepatitis virus and type 3 duck hepatitis virus, because according to the International Virology Classification Committee in recent years, the traditional type 2 duck hepatitis virus has been Type 1 duck...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/576
CPCG01N33/5768
Inventor 孙庆歌廖园园赖志朱薇肖爱芳祝春花李晶梅漆世华谢红玲冯钊
Owner WUHAN CHOPPER BIOLOGY