Magnaporthe oryzae avirulence gene AvrPib specific molecular marker, and method and application thereof

A molecular marker, the technology of rice blast fungus, applied in the field of genetic engineering, can solve the problems of heavy workload, unstable resistance of disease-resistant varieties, results easily affected by seasonal restrictions and environmental conditions, etc.

Active Publication Date: 2015-02-04
SOUTH CHINA AGRI UNIV
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the diversity and variability of the blast fungus population, the resistance of resistant varieties is unstable, so that the problem of susceptibility of resistant varieties has not been resolved.
However, the physiological races of this method are often different due to the different identification varieties used, and the workload is large. The results are easily affected by seasonal restrictions and environmental conditions, and it is difficult to objectively and truly reflect the physiological races and species of Magnaporthe grisea. its group structure

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Magnaporthe oryzae avirulence gene AvrPib specific molecular marker, and method and application thereof
  • Magnaporthe oryzae avirulence gene AvrPib specific molecular marker, and method and application thereof
  • Magnaporthe oryzae avirulence gene AvrPib specific molecular marker, and method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Avirulent Gene of Magnaporthe grisea AvrPib Bitcloning of

[0029] (1) AvrPib Construction of locus genetic map

[0030] In order to discover and identify the avirulence gene of Magnaporthe grisea AvrPib , using the blast fungus strain CHL357 (mating type MAT1-1 ; for containing Pib The rice cultivar IRBLb-B exhibited toxicity; Hua et al. 2012, Theor Appl Genet 125: 1047-1055) and CHL42 (mating type MAT1-2 ; showed no toxicity to IRBLb-B; Zhai et al. 2014, Plos One 9: e98067) 83 offspring ascospore strains obtained from crossing were inoculated into rice variety IRBLb-B (Kobayashi et al. 2007, JARQ 41: 31-37) , the results showed that there were 41 avirulent (non-pathogenic) strains and 42 virulent (pathogenic) strains in this mapping group, and the segregation ratio was 1:1. It was inferred that the avirulence of CHL42 to rice variety IRBLb-B was controlled by a pair of dominant genes.

[0031] In order to quickly determine the chromosomal locatio...

Embodiment 2

[0065] Example 2 AvrPib The gene structure, protein sequence and mutants of

[0066] (1) AvrPib Inference of gene structure: using the step-by-step method for AvrPib The DNA sequence of the gene was determined, and the coding region of the gene was predicted by software such as DNAStar. Wherein, SEQ ID NO: 5 and SEQ ID NO: 6 are respectively AvrPib Genomic DNA and cDNA sequences. AvrPib Genomic DNA was 2618 bp in length, and its full-length cDNA was 637 bp, containing an open reading frame of 225 bp, and the 5' and 3' untranslated regions were 322 bp and 90 bp, respectively. By comparing genomic DNA and cDNA, it was found that the open reading frame of the gene has only one exon and no intron ( image 3 a).

[0067] (2) AvrPib Presumption of protein sequence: using software such as DNAStar to AvrPib The protein sequence encoded by the gene was predicted, and the result is shown in SEQ ID NO:7. AvrPib It encodes a protein polypeptide consisting of 75 amino acid resid...

Embodiment 3

[0088] Example 3 AvrPib Application of Specific Molecular Markers in Population Monitoring of Magnaporthe grisea

[0089] (1) AvrPib Design of specific molecular markers: obtained by using Example 2 AvrPib Genomic DNA sequence (SEQ ID NO: 5) pair AvrPib Genomic sequences on both sides of the site were compared and analyzed. The results showed that the genome sequences on both sides of it had high specificity and great variability, especially the transposon in its 5'upstream region ( Pot2 , Pot3 ;Such as image 3 shown) will result in a loss of function. Therefore, 2 pairs of primers were designed in its coding region and its two sides ( AvrPib F1 / R1; AvrPib F2 / R2), as its specific molecular marker ( Figure 5 a).

[0090] The primer sequences are as follows:

[0091] AvrPib F1: GGACAAGGGAGGCAAATCTAAC

[0092] AvrPib R1: ATGCCGACAATGCGAGGTAT

[0093] AvrPib F2: TGGAGAAGACTTTGATGC

[0094] AvrPib R2: GAACGCATAATGGCAACTA

[0095] (2) AvrPib Application of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene engineering, and particularly discloses a Magnaporthe oryzae avirulence gene AvrPib specific molecular marker, and a method and application thereof. The sequences of the molecular marker are as shown in SEQ ID NO:1-4. By using the molecular marker, a Magnaporthe oryzae natural population pathogenicity variation molecule detection system can be established, and the distribution of the gene in natural population in the field and the dynamic change rule thereof can be known and mastered, thereby guiding the breeding for resistance to rice blast and the rational distribution and alternation of species in various regions. Thus, the breeding efficiency is improved, rice blast can be controlled more effectively, and a new strategy for comprehensively controlling rice blast can be designed accordingly.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a non-toxic gene of rice blast fungus AvrPib Specific molecular markers and their methods and applications. Background technique [0002] Rice ( Oryza sativa L. ) is an important food crop and an important industrial raw material for the survival of billions of people in the world, and it is also the host of various diseases and insect pests. by pathogenic fungi Magnapothe oryzae The rice blast caused by rice blast is one of the most devastating diseases in rice production in the world, causing 10-30% rice yield loss every year. Moreover, the fungus can also infect more than 50 kinds of gramineous plants such as wheat and cereals. [0003] From the point of view of environmental protection and agricultural sustainable development, the breeding and utilization of disease-resistant varieties is the safest and most effective way to control rice blast. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12Q1/68C12Q1/04
Inventor潘庆华张树林何丽云杨先锋王玲
OwnerSOUTH CHINA AGRI UNIV