Supercharge Your Innovation With Domain-Expert AI Agents!

Cecropins obtained from Aedes aegypti, coding gene and applications thereof

A coding and gene technology, which is applied in application, genetic engineering, plant genetic improvement, etc., can solve the problem of limiting the growth of viruses or other pathogenic microorganisms, and achieve the effects of reducing infection ability, broad application prospects, and reducing inhibition

Active Publication Date: 2015-04-15
TSINGHUA UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although mosquitoes can transmit viruses, they do not get sick themselves, indicating that the immune system in mosquitoes limits the growth of viruses or other pathogenic microorganisms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cecropins obtained from Aedes aegypti, coding gene and applications thereof
  • Cecropins obtained from Aedes aegypti, coding gene and applications thereof
  • Cecropins obtained from Aedes aegypti, coding gene and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1, DENV-2 induces the expression of AaCECN gene in Aedes aegypti

[0038] 1. Group processing

[0039] Experimental group (24 Aedes aegypti): Inoculate Aedes aegypti with dengue type 2 virus (10MID per Aedes aegypti via pleural injection) 50 DENV-2 with an injection volume of 300nL);

[0040] Control group (22 Aedes aegypti): Each Aedes aegypti was injected with 300nL PBS buffer through the chest cavity.

[0041] 2. Six hours after the inoculation in step 1, the total RNA of Aedes aegypti was extracted and reverse-transcribed into cDNA, and the expression of AaCECN gene in Aedes aegypti was detected by fluorescent quantitative PCR (SYBR Green) (Actin gene was used as an internal reference).

[0042] The primers used to identify the AaCECN gene are as follows:

[0043] Upstream primer: 5'-CGGCAAGAAATTGGAAAAAGTC-3';

[0044] Downstream primer: 5'-GAATCGATCATCCTAGGGCC-3'.

[0045] The primers used to identify the Actin gene are as follows:

[0046] Upstream p...

Embodiment 2

[0049] Embodiment 2, the application of the substance that suppresses AaCECN gene expression in promoting dengue fever virus replication

[0050] 1. Preparation of dsRNA

[0051] 1. The primers designed to prepare the coding DNA of the dsRNA that inhibits AaCECN gene expression are as follows:

[0052] AaCECN-F: 5'- GCGCTCCGTCGATCAAGTTC-3';

[0053] AaCECN-R: 5'- CAGTGTCTTTTCACAATTTAAATCAG-3'.

[0054] In the above primers, the framed region is the T7 promoter sequence.

[0055] 2. Extracting the total RNA of Aedes aegypti and reverse-transcribing it into cDNA, using the cDNA as a template, performing PCR amplification with a primer pair composed of AaCECN-F and AaCECN-R to obtain a PCR amplification product.

[0056] 3. Take the PCR amplification product obtained in step 2, use Ambion MEGAscriptT7High Yield Transcription Kit (catalogue number: AM1334) and perform in vitro transcription according to the kit instructions. Since both AaCECN-F and AaCECN-R have T7 promoter...

Embodiment 3

[0081] Embodiment 3, the application of AaCECN protein in inhibiting virus replication

[0082] 1. Construction of recombinant plasmid pMT-AaCECN-V5-HisA

[0083] 1. Synthesize single-stranded DNA molecule A and single-stranded DNA molecule B respectively, and obtain double-stranded DNA molecules after annealing (in single-stranded DNA molecule A and single-stranded DNA molecule B, the part in the recognition sequence of the restriction endonuclease is underlined , the resulting double-stranded DNA molecule has a sticky end of the restriction endonuclease BglII upstream and a sticky end of the restriction endonuclease XhoI downstream).

[0084] Single-stranded DNA molecule A:

[0085] 5'- GATCT CAGCAACAGTGCGGCGTGGAAGCGGCGCCCAGGTGGAAATTCGGCAAGAAATTGGAAAAAGTCGGGAAAAATGTGTTTAACGCTGCTAAGAAGGCACTGCCAGTCGTTGCCGGGTACAAGGCCCTAGGA C -3'

[0086] Single-stranded DNA molecule B:

[0087] 5'- TCGAG TCCTAGGGCCTTGTACCCGGCAACGACTGGCAGTGCCTTCTTAGCAGCGTTAAACACATTTTCCCGACTTTTTCCAATTTCTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses Cecropins obtained from Aedes aegypti, a coding gene and applications thereof. According to the present invention, the protein of the present invention is the following (a) or (b) or (c): (a) the protein comprises amino acid residues at sites 20-62 from the N terminal in the sequence 1 in the sequence table, (b) the protein comprises an amino acid sequence represented by the sequence 1 in the sequence table, and (c) the protein is formed by carrying out substitution, and / or deletion and / or addition of one or a plurality of amino acids on the (a) or (b), has the antibacterial peptide function, and is derived from the (a) or (b); results of the present invention further prove that the dengue virus infection capability can be effectively reduced with the AaCECN protein; and the broad application prospects are provided.

Description

technical field [0001] The invention relates to cecropin obtained from Aedes aegypti, its coding gene and application. Background technique [0002] Cecropins (cecropins) is the earliest discovered insect antimicrobial peptides, in 1980, by Boman et al. isolated from silkworm pupae. This kind of polypeptide antibiotics generally contains 37-39 amino acid residues and does not contain cysteine. Its N-terminal region is strongly basic and can form a nearly perfect amphipathic helix structure, while the C-terminal region can form a hydrophobic helix. There is a hinge region formed by glycine and proline between them, and the C-termini of most polypeptides are amidated, and amidation plays an important role in their antibacterial activity. [0003] The mechanism of action of antimicrobial peptides can be divided into two types, that is, the mechanism of membrane structure destruction and the mechanism of non-membrane structure destruction. [0004] (1) Membrane structure destr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435C07K19/00C12N15/12C12N15/62C12N15/85C12N5/10A61K38/17A61P31/14
CPCA61K38/00C07K14/43563C07K2319/00Y02A50/30
Inventor 程功肖小平
Owner TSINGHUA UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More