Monoclonal antibody capable of antagonizing and inhibiting bonding of programmed death-1 receptor (PD-1) and ligand thereof as well as encoding sequence and use of monoclonal antibody

A programmed death and PD-1 technology, applied in the direction of anti-receptor/cell surface antigen/cell surface determinant immunoglobulin, antibody mimic/scaffold, anti-animal/human immunoglobulin, etc., can solve adverse events Reactions, high security risks and uncertainties

Active Publication Date: 2015-04-29
ACROIMMUNE BIOTECH CO LTD
View PDF3 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Directly increasing the expression of co-stimulatory factors such as CD28 can achieve the effect of upregulating immune function, but in a phase I clinical study involving an anti-CD28 monoclonal antibody drug code-named TGN1412 conducted in the UK in 2006, 6 healthy subjects The patient had extremely serious adverse reactions on the day of receiving the injection of the antibody drug (Suntharalingam G et al.: Cytokine storm in a phase 1 trial of the anti-CD28 monoclonal antibody TGN1412
NEJM2006,355: 1018-1028), so the current scientific community generally believes that the clinical application of agonistic anti-CD28 antibody drugs has high safety risks and uncertainties, and there are many concerns about their future development and marketing prospects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Monoclonal antibody capable of antagonizing and inhibiting bonding of programmed death-1 receptor (PD-1) and ligand thereof as well as encoding sequence and use of monoclonal antibody
  • Monoclonal antibody capable of antagonizing and inhibiting bonding of programmed death-1 receptor (PD-1) and ligand thereof as well as encoding sequence and use of monoclonal antibody
  • Monoclonal antibody capable of antagonizing and inhibiting bonding of programmed death-1 receptor (PD-1) and ligand thereof as well as encoding sequence and use of monoclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1: Establishment and screening identification of mouse hybridoma cell lines secreting anti-PD-1 antibody

[0057] Step 1. Obtaining recombinant human PD-1 protein (immunization antigen) and animal immunization

[0058] In the embodiment of the present invention, the human PD-1 protein used for immunization is the recombinant human PD-1 extracellular protein expressed by mammals (product of Beijing Yiqiao Shenzhou Company). After the recombinant human PD-1 protein was mixed with complete Freund's adjuvant (product of Sigma, USA), Balb / c mice were injected subcutaneously at multiple points (100 μl / mouse, 5-10 μg PD-1 protein in total). 2-3 weeks after the first immunization, the mice were injected subcutaneously with a mixture containing PD-1 protein and Freund's incomplete adjuvant (product of Sigma, USA). After 2-3 booster immunizations, a small amount of mouse serum was taken , using the 96-plate coated with human PD-1 protein to detect the titer of anti-PD-1 an...

Embodiment 2

[0065] Example 2 Flow cytometry detection and analysis of the binding of murine AB7 monoclonal antibody to CHO cells transfected with human PD-1 gene

[0066] In this example, the AB7 antibody was used as the primary antibody, and FITC fluorescently labeled goat anti-mouse IgG was used as the secondary antibody, and flow cytometry was used to detect and analyze the binding of the AB7 antibody to CHO cells transfected with the human PD-1 gene. To this end, total mRNA was first extracted from human peripheral blood lymphocytes (PBL), and then amplified in vitro by Reverse transcription-polymerase chain reaction (RT-PCR) to obtain the full-length protein encoding PD-1 (including extracellular and intracellular region) cDNA fragment. The primers used for RT-PCR are PD-1 forward primers: ATTAAGCTTGAGCAGTGGAGAAGGCGGCA, Seq ID No: 11 , PD-1 reverse primer: AATTGGATCCCTCCTGAGGAAATGGGCTGA, Seq ID No: 12 ). The cDNA fragment amplified by the pair of primers covers the entire coding...

Embodiment 3

[0068] Example 3. In vitro preparation and purification of mouse-derived anti-human PD-1 monoclonal antibody (AB7)

[0069] In this example, the mouse anti-human PD-1 monoclonal antibody (AB7) protein was obtained by separation and purification by affinity chromatography.

[0070] Its purification steps are as follows:

[0071] After the AB7 hybridoma cells were amplified, they were inoculated in 200-500ml of serum-free 1640 medium, cultured at 37°C for 5 days, then the culture supernatant was collected, filtered through a 0.45μm filter membrane, and loaded onto Protein G-Sepharose Fast Flow (purchased from General Electric GE Company) affinity chromatography column; the chromatography column was first rinsed with PBS solution to remove impurity proteins, and then the adsorbed AB7 antibody was eluted with low pH (2.7-3.0) glycine (0.1M) solution protein. The eluate was adjusted to pH 7.0 with 1mol / L Tris (pH8.5-9.0), and then dialyzed against 10 times the volume of PBS solut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed in the present invention are a mouse monoclonal antibody for antagonizing and inhibiting the binding of a programmed death-1 (PD-1) to the ligand thereof, and the heavy chain variable region and light chain variable region amino acid sequences thereof. Also disclosed in the present invention is a DNA molecule nucleotide sequence encoding the heavy chain variable region and light chain variable region of the antibody. Also disclosed in the present invention are a method for preparing a human-mouse chimeric antibody of the antibody and derivatives thereof, and the use thereof in PD-1 protein detection.

Description

technical field [0001] The invention belongs to the field of biotechnology-monoclonal antibody. The invention relates to a monoclonal antibody that antagonizes and inhibits the binding of programmed death receptor PD-1 (programmed death-1) and its ligand, its coding sequence and application. Background technique [0002] For a long time, the biomedical community has always believed that the occurrence and development of tumors are closely related to the state of immune function in the body. Under normal conditions, the immune function in the body plays a role in monitoring the mutated tumor cells and inhibiting the development of tumors. However, when the immune function in the body is low or the function is inhibited, the mutation and growth of tumor cells will be accelerated, and even life-threatening in severe cases. Therefore, immunotherapy (Immunotherapy) aimed at improving immune function has become a major goal and means in the international clinical treatment of tu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/28C12N15/13C12N15/85C12N5/10G01N33/68G01N33/577
CPCC07K16/2818C07K2317/76C07K2319/30
Inventor罗师平胡红群宋晓琦陈蕞孙亚男蔡明文袁燕萍周建鹰罗昊刘海云周群敏徐一清
OwnerACROIMMUNE BIOTECH CO LTD