Wheat salt-tolerant gene TaBASS2 and application thereof

A wheat salt tolerance gene and gene technology, applied in application, genetic engineering, plant genetic improvement and other directions, to achieve the effect of improving salt tolerance

Inactive Publication Date: 2015-04-29
SHANDONG UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report about the cDNA nucleotide sequence of pyruvate transporter (BASS) gene TaBASS2 and the application of this gene in cultivating salt-tolerant plants after retrieval

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wheat salt-tolerant gene TaBASS2 and application thereof
  • Wheat salt-tolerant gene TaBASS2 and application thereof
  • Wheat salt-tolerant gene TaBASS2 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1, Cloning of Shanrong No. 3 Wheat Salt Tolerance Gene Allene Oxide Reductase Gene TaBASS2

[0020] 1.1 Processing of plant material

[0021] 1) Vernalization of wheat seeds (Shanrong No. 3) at 4°C for 20 days

[0022] 2) Treat the seeds with 70% alcohol for 2-3 minutes.

[0023] 3) Discard the alcohol, wash with sterile water for 3-5 times, shake and mix well each time.

[0024] 4) Soak the seeds in sterile water, avoid light, incubate overnight at 25°C, 40-60rpm / min, on a shaking table.

[0025] 5) Place the seeds face up on filter paper fully moistened with sterile water, and germinate in the dark.

[0026] 6) After 3 days, the seeds were transferred to the culture basket, 1 / 2 Hoagland, hydroponics, placed at 23°C, and grown to the stage of two leaves and one heart in the long-day culture room.

[0027] 1.2 Wheat RNA extraction

[0028] 1) Weigh the cryogenically frozen 30-50 mg RNA extraction sample and quickly transfer it to a mortar pre-cooled with li...

Embodiment 2

[0060] Embodiment 2, expression analysis of TaBASS2

[0061] 2.1 Extraction of RNA under stress

[0062] The seeds of Shanrong 3 and Jinan 177 germinated normally. When the Hoagland culture medium was cultured to the stage of two leaves and one heart (about 3 weeks), the treatments of drought (18% PEG), salt stress (200mM NaCl), cold and ABA began. After treatment for different time, the seedling root and leaf RNA was extracted by Trizol method as above.

[0063] 2.2 Reverse transcription to obtain cDNA

[0064] Reverse transcription generated cDNA as above.

[0065] 2.3 PCR reaction and electrophoresis

[0066] 1) Using cDNA as a template, carry out PCR reaction. Primers are as follows:

[0067] QRT-1: ATAGCGATGACACCACTCCT

[0068] QRT-2: TTTCAACACTTCTGCGACTT

[0069] 2) PCR system:

[0070]

[0071]

[0072] 3) PCR program:

[0073] 95°C for 5min; 25~30cycles 95°C for 30s, 60°C for 30s, 72°C for 30s; 72°C for 5min.

[0074] The number of PCR cycles was determ...

Embodiment 3

[0076] Embodiment 3, change TaBASS2 wheat salt tolerance analysis

[0077] The plant expression vector pGA626 is an expression vector containing a ubiquitin promoter, and its multiple cloning site contains recognition sites for restriction endonucleases HindIII and BamHI. Based on this, design primers containing HindIII and BamHI recognition sequences upstream of the start codon and downstream of the stop codon of the target gene, use high-fidelity Taq enzyme to amplify the target gene, and use restriction enzymes HindIII and BamHI to amplify the vector pGA626 and the target gene The product fragments were digested separately. The fully digested carrier is separated by electrophoresis on 1% agarose gel, recovered by gel, and connected with the amplified fragment of the digested target gene. Transform Escherichia coli competent, use the primer tttagccctgccttcatacg on the carrier and the downstream primers of the gene for PCR identification, and use HindIII and BamHI for enzyme...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a wheat salt-tolerant gene pyruvic acid transporter gene, and particularly relates to an allene oxide reductase gene TaBASS2 and a plant expression vector containing the gene TaBASS2. The invention further discloses an application of the gene TaBASS2 in cultivation of salt-tolerant plants, especially wheat. An experiment proves that the salt tolerance of a transgenic plant prepared by transgene transformation disclosed by the invention is obviously improved; and a foundation is laid for wide application of the gene in cultivation of a new variety of salt-tolerant crops.

Description

technical field [0001] The invention relates to a wheat salt-tolerant gene and its application, in particular to a wheat salt-tolerant gene pyruvate transporter gene TaBASS2 and its application, and belongs to the technical field of biogenetic engineering. Background technique [0002] Soil salinization seriously affects crop yields. Especially with the development of industry, soil salinization is becoming more and more serious, which has become a social problem of global concern. my country has a large population, and soil salinization is more serious, which has become an important factor restricting my country's economic and social development. Therefore, in addition to alleviating soil salinization, cultivating new varieties of salt-tolerant crops has become a very urgent task at present. [0003] It is a technology with broad application prospects to use transgenic improved plant technology to transfer new traits into high-biomass plants to develop new high-efficiency...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N15/82A01H5/00
Inventor夏光敏爱兴辉赵阳王勐骋
OwnerSHANDONG UNIV