Supercharge Your Innovation With Domain-Expert AI Agents!

Cloning method of microrna precursor gene in Phyllostachys pubescens

A cloning method, the technology of moso bamboo, applied in the field of plant molecular biology, can solve the problems such as no successful precedents, and achieve the effect of improving specificity and good effect

Active Publication Date: 2017-06-23
INT CENT FOR BAMBOO & RATTAN
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The object of the present invention is to provide the cloning method of moso bamboo miRNA precursor gene, to overcome the defect that there is no successful precedent in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cloning method of microrna precursor gene in Phyllostachys pubescens
  • Cloning method of microrna precursor gene in Phyllostachys pubescens
  • Cloning method of microrna precursor gene in Phyllostachys pubescens

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Cloning of embodiment 1 miR319a precursor gene (153bp)

[0039] 1. Template: Extract plant genomic DNA and use plant genomic DNA as a template.

[0040] The sequences of the upstream and downstream primers are:

[0041] miR319a Prime F: TAGGATCCCTTCAGTCCACTCTCAGATGGC (SEQ ID NO. 1)

[0042] miR319a Prime R: CCAAGCTTCTTCAGTCCAACCACAAACAAC (SEQ ID NO. 2)

[0043] 2. The 20μL PCR system is:

[0044]

[0045] 3. PCR reaction conditions:

[0046] Pre-denaturation at 94°C for 5 minutes; 30 cycles of 94°C for 30s, 66°C for 30s, and 72°C for 30s; 72°C for 10 minutes.

[0047] 4. Agarose gel electrophoresis:

[0048] (1) Prepare 0.0125g / mL agarose gel.

[0049] (2) Electrophoresis voltage 100V, electrophoresis time 26min.

[0050] see results figure 1 , only one specific amplification band appeared in the amplification result, the band was clear, neat, high brightness, and the size was consistent with the expected size.

[0051] The PCR product was recovered by the a...

Embodiment 2

[0056] The cloning method of embodiment 2mi4414b precursor gene (81bp)

[0057] 1. Template: Extract plant genomic DNA and use plant genomic DNA as a template.

[0058] The sequences of the upstream and downstream primers are:

[0059] mi4414b Prime F: TAGGATCCCTGCCGACTCATTCACCCAC (SEQ ID NO. 3)

[0060] mi4414b Prime R: CGAAGCTTAACTTTACCTCCCGCTTCATTC (SEQ ID NO. 4)

[0061] 2. PCR system:

[0062] 20μL PCR system is:

[0063]

[0064] 3. Reaction conditions:

[0065] Pre-denaturation at 94°C for 5 minutes; 32 cycles of 94°C for 30s, 68°C for 30s, and 72°C for 30s; 72°C for 10 minutes.

[0066] 4. Agarose gel electrophoresis:

[0067] (1) Prepare 0.0125g / mL agarose gel.

[0068] (2) Electrophoresis voltage 90V, electrophoresis time 29min.

[0069] After the PCR product was recovered by the agarose gel electrophoresis recovery kit, it was connected to the cloning vector pMD18-T Vector, transformed into DH5α competent cells, and single clones were selected on the LB p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a cloning method of microRNA precursor genes of moso bamboos. The cloning method comprises the following steps: respectively optimizing a PCR amplification system and PCR reaction conditions of the microRNA precursor genes of the moso bamboos, reducing the dosage of primers, increasing the number of formworks, controlling an annealing temperature to be 66-68 DEG C, controlling the number of times of cycle to be 30-32, changing the gel concentration, the voltage and the electrophoresis time of agarose gel electrophoresis, and realizing the purpose of efficiently cloning the microRNA precursor genes of the moso bamboos. The method disclosed by the invention is high in specificity, the quantity of target gene products is high, a base mispairing phenomenon is avoided in a key mature sequence region of the precursor genes, and the homology of the obtained precursor gene sequence and a target gene sequence is as high as 100%; the further construction of a plant expression vector is facilitated, the cloning method is used for cultivating genetically modified plants, and the cloning method has favorable application prospects in the respects of heredity improvement and molecular cultivation of farming and forestry crops.

Description

technical field [0001] The invention relates to the field of plant molecular biology, in particular to a method for cloning the microRNA precursor gene of moso bamboo. Background technique [0002] Moso bamboo (Phyllostachys edulis) belongs to the Gramineae Bamboo subfamily (Bambusadea) and is widely distributed in more than 20 provinces and regions in my country. It is the largest and most widely distributed dual-purpose bamboo species in China. Moso bamboo has a wide range of uses and can be used as raw materials or materials for construction, agricultural tools, papermaking, furniture and handicrafts, and is an important economic crop. Moso bamboo is a single plant, which blooms once in a lifetime, and belongs to the type that all bloom in pieces. The flowering of moso bamboo is characterized by rarity, randomness, and uncertainty. Even in a region, the flowering sequence of each bamboo forest or bamboo clump is different, and the duration is quite long. After the moso ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/10C12N15/11C12N15/82A01H5/00
Inventor 高健葛伟
Owner INT CENT FOR BAMBOO & RATTAN
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More