Cloning method of microrna precursor gene in Phyllostachys pubescens
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A cloning method, the technology of moso bamboo, applied in the field of plant molecular biology, can solve the problems such as no successful precedents, and achieve the effect of improving specificity and good effect
Active Publication Date: 2017-06-23
INT CENT FOR BAMBOO & RATTAN
View PDF3 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0005] The object of the present invention is to provide the cloning method of moso bamboo miRNA precursor gene, to overcome the defect that there is no successful precedent in the prior art
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0038] Cloning of embodiment 1 miR319a precursor gene (153bp)
[0039] 1. Template: Extract plant genomic DNA and use plant genomic DNA as a template.
[0040] The sequences of the upstream and downstream primers are:
[0041] miR319a Prime F: TAGGATCCCTTCAGTCCACTCTCAGATGGC (SEQ ID NO. 1)
[0042] miR319a Prime R: CCAAGCTTCTTCAGTCCAACCACAAACAAC (SEQ ID NO. 2)
[0043] 2. The 20μL PCR system is:
[0044]
[0045] 3. PCR reaction conditions:
[0046] Pre-denaturation at 94°C for 5 minutes; 30 cycles of 94°C for 30s, 66°C for 30s, and 72°C for 30s; 72°C for 10 minutes.
[0047] 4. Agarose gel electrophoresis:
[0048] (1) Prepare 0.0125g / mL agarose gel.
[0049] (2) Electrophoresis voltage 100V, electrophoresis time 26min.
[0050] see results figure 1 , only one specific amplification band appeared in the amplification result, the band was clear, neat, high brightness, and the size was consistent with the expected size.
[0051] The PCR product was recovered by the a...
Embodiment 2
[0056] The cloning method of embodiment 2mi4414b precursor gene (81bp)
[0057] 1. Template: Extract plant genomic DNA and use plant genomic DNA as a template.
[0058] The sequences of the upstream and downstream primers are:
[0059] mi4414b Prime F: TAGGATCCCTGCCGACTCATTCACCCAC (SEQ ID NO. 3)
[0060] mi4414b Prime R: CGAAGCTTAACTTTACCTCCCGCTTCATTC (SEQ ID NO. 4)
[0061] 2. PCR system:
[0062] 20μL PCR system is:
[0063]
[0064] 3. Reaction conditions:
[0065] Pre-denaturation at 94°C for 5 minutes; 32 cycles of 94°C for 30s, 68°C for 30s, and 72°C for 30s; 72°C for 10 minutes.
[0066] 4. Agarose gel electrophoresis:
[0067] (1) Prepare 0.0125g / mL agarose gel.
[0068] (2) Electrophoresis voltage 90V, electrophoresis time 29min.
[0069] After the PCR product was recovered by the agarose gel electrophoresis recovery kit, it was connected to the cloning vector pMD18-T Vector, transformed into DH5α competent cells, and single clones were selected on the LB p...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention provides a cloning method of microRNA precursor genes of moso bamboos. The cloning method comprises the following steps: respectively optimizing a PCR amplification system and PCR reaction conditions of the microRNA precursor genes of the moso bamboos, reducing the dosage of primers, increasing the number of formworks, controlling an annealing temperature to be 66-68 DEG C, controlling the number of times of cycle to be 30-32, changing the gel concentration, the voltage and the electrophoresis time of agarose gel electrophoresis, and realizing the purpose of efficiently cloning the microRNA precursor genes of the moso bamboos. The method disclosed by the invention is high in specificity, the quantity of target gene products is high, a base mispairing phenomenon is avoided in a key mature sequence region of the precursor genes, and the homology of the obtained precursor gene sequence and a target gene sequence is as high as 100%; the further construction of a plant expression vector is facilitated, the cloning method is used for cultivating genetically modified plants, and the cloning method has favorable application prospects in the respects of heredity improvement and molecular cultivation of farming and forestry crops.
Description
technical field [0001] The invention relates to the field of plant molecular biology, in particular to a method for cloning the microRNA precursor gene of moso bamboo. Background technique [0002] Moso bamboo (Phyllostachys edulis) belongs to the Gramineae Bamboo subfamily (Bambusadea) and is widely distributed in more than 20 provinces and regions in my country. It is the largest and most widely distributed dual-purpose bamboo species in China. Moso bamboo has a wide range of uses and can be used as raw materials or materials for construction, agricultural tools, papermaking, furniture and handicrafts, and is an important economic crop. Moso bamboo is a single plant, which blooms once in a lifetime, and belongs to the type that all bloom in pieces. The flowering of moso bamboo is characterized by rarity, randomness, and uncertainty. Even in a region, the flowering sequence of each bamboo forest or bamboo clump is different, and the duration is quite long. After the moso ...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more