Application of lepidoptera antibiotic peptide Lebocin to pest control
A technology of lepidopteran insects and antibacterial peptides, which is applied in the application, insecticide, animal repellent and other directions to achieve the effect of reducing harm
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 The midgut cortex of Spodoptera litura with suppressed expression of Lebocin becomes thinner and the body dies
[0030] 1) Construction of Spodoptera litura antimicrobial peptide LebocindsRNA vector
[0031] Spodoptera litura Lebocin was cloned and ligated into pMD 18T-Vector (TaKaRa), and the Lebocin cDNA fragment (SEQ ID NO: 1) with sticky ends was obtained by double enzyme digestion; the fragment was ligated with the L4440 vector with the same sticky ends , to obtain the Lebocin dsRNA vector, the obtained Lebocin dsRNA sequence is shown in SEQ ID NO: 2, and construct the GFP dsRNA vector as a control at the same time, and its construction method is the same as that of the Lebocin dsRNA.
[0032] The above cDNA fragment of Spodoptera litura Lebocin (SEQ ID NO: 1) is:
[0033]5’-ATGGGTAAAGTAATTCTTGTACTTTCTGTGCTCGCGGTCTTTTTGGTCGCTGAGTCATCATGCCAGAAATTCATTAGACCTACGTACAGACCTCCACGGCCACGTTACACAGTGGGACCAGTTCGTCCTCATTTAAGAATTCGCCGTGATGCGGGTGACGAGCCGCTCTGGTTGTATC...
Embodiment 2
[0040] Example 2 The midgut cortex of Bombyx mori larvae whose expression of Lebocin is inhibited becomes thinner and the worm body dies
[0041] 1) Synthesis of silkworm antimicrobial peptide LebocindsRNA
[0042] According to the instructions of the kit T7 RiboMAX® Express RNAi System (purchased from Promega Company), the dsRNAs of silkworm antimicrobial peptide Lebocin, lysozyme, and GFP were synthesized respectively. The dsRNA sequences of the three are as follows:
[0043] The Bombyx mori Lebocin dsRNA sequence (SEQ ID NO: 3) is:
[0044] 5’-AUGUACAAGUUUUUAGUAUUCAGUUCAGUUCUGGUGCUGUUCUUUGCUCAGGCUUCGUGCCAGAGGUUCAUCCAGCCGACCUUCAGGCCACCGCCAACACAGCGCCCGAUAACACGUACAGUGCGACAAGCUGGCCAGGAACCGCUAUGGCUGUAUCAAGGUGACAAUGUUCCUCGUGCGCCAAGUACCGCAGACCAUCCGAUUCUUCCUUCGAAAAUCGACGACGUGCAGCUCGAUCCAAACCGAAGGUAUGUUCGCAGUGUCACCAAUCCAGAAAAUAACGAGGCGUCCAUUGAACAUUCACAUCAUACAGUUGAUAUUGGACUUGACCAGCCGAUCGAGAGCCACCGUAACACAAGGGACCUGCGGUUUUUGUACCCUCGAGGGAAACUGCCUGUUCCAACGCUUCCUCCGUUUAACCCCAAGCCAAUAUA...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com