Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of lepidoptera antibiotic peptide Lebocin to pest control

A technology of lepidopteran insects and antibacterial peptides, which is applied in the application, insecticide, animal repellent and other directions to achieve the effect of reducing harm

Inactive Publication Date: 2015-09-09
SOUTH CHINA NORMAL UNIVERSITY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, it has been clear that the transcription factor Ets regulates the expression of Lebocin in silkworm, but it is only confirmed that it is the result of Escherichia coli induction (Tanaka et al., BmEts upregulates promoter activity of Lebocin in Bombyx mori , Insect Biochem Mol Biol. , 2012, 42 (7): 474-481)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of lepidoptera antibiotic peptide Lebocin to pest control
  • Application of lepidoptera antibiotic peptide Lebocin to pest control
  • Application of lepidoptera antibiotic peptide Lebocin to pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 The midgut cortex of Spodoptera litura with suppressed expression of Lebocin becomes thinner and the body dies

[0030] 1) Construction of Spodoptera litura antimicrobial peptide LebocindsRNA vector

[0031] Spodoptera litura Lebocin was cloned and ligated into pMD 18T-Vector (TaKaRa), and the Lebocin cDNA fragment (SEQ ID NO: 1) with sticky ends was obtained by double enzyme digestion; the fragment was ligated with the L4440 vector with the same sticky ends , to obtain the Lebocin dsRNA vector, the obtained Lebocin dsRNA sequence is shown in SEQ ID NO: 2, and construct the GFP dsRNA vector as a control at the same time, and its construction method is the same as that of the Lebocin dsRNA.

[0032] The above cDNA fragment of Spodoptera litura Lebocin (SEQ ID NO: 1) is:

[0033]5’-ATGGGTAAAGTAATTCTTGTACTTTCTGTGCTCGCGGTCTTTTTGGTCGCTGAGTCATCATGCCAGAAATTCATTAGACCTACGTACAGACCTCCACGGCCACGTTACACAGTGGGACCAGTTCGTCCTCATTTAAGAATTCGCCGTGATGCGGGTGACGAGCCGCTCTGGTTGTATC...

Embodiment 2

[0040] Example 2 The midgut cortex of Bombyx mori larvae whose expression of Lebocin is inhibited becomes thinner and the worm body dies

[0041] 1) Synthesis of silkworm antimicrobial peptide LebocindsRNA

[0042] According to the instructions of the kit T7 RiboMAX® Express RNAi System (purchased from Promega Company), the dsRNAs of silkworm antimicrobial peptide Lebocin, lysozyme, and GFP were synthesized respectively. The dsRNA sequences of the three are as follows:

[0043] The Bombyx mori Lebocin dsRNA sequence (SEQ ID NO: 3) is:

[0044] 5’-AUGUACAAGUUUUUAGUAUUCAGUUCAGUUCUGGUGCUGUUCUUUGCUCAGGCUUCGUGCCAGAGGUUCAUCCAGCCGACCUUCAGGCCACCGCCAACACAGCGCCCGAUAACACGUACAGUGCGACAAGCUGGCCAGGAACCGCUAUGGCUGUAUCAAGGUGACAAUGUUCCUCGUGCGCCAAGUACCGCAGACCAUCCGAUUCUUCCUUCGAAAAUCGACGACGUGCAGCUCGAUCCAAACCGAAGGUAUGUUCGCAGUGUCACCAAUCCAGAAAAUAACGAGGCGUCCAUUGAACAUUCACAUCAUACAGUUGAUAUUGGACUUGACCAGCCGAUCGAGAGCCACCGUAACACAAGGGACCUGCGGUUUUUGUACCCUCGAGGGAAACUGCCUGUUCCAACGCUUCCUCCGUUUAACCCCAAGCCAAUAUA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of lepidoptera antibiotic peptide Lebocin to pest control. According to the invention, with an expression for inhibiting antibiotic peptide Lebocin, midgut cortex of lepidoptera insects becomes thin, and insect bodies die. However, the reason for thinning of midgut cortex is not the antibacterial action of antibiotic peptide Lebocin, and after insects are fed with different bacteria, the expression of Lebocin in insect midgut does not change obviously while the expression of Lebocinin fat bodies of immune organs is increased obviously, indicating that the high expression of Lebocin in midgut in a metamorphosis period is irrelevant to the antibacterial action of Lebocin, but Lebocin responds to a signal of ecdysone starting development by metamorphosis so as to participate in formation of midgut cortex; Lebocin is related to development and intestinal regeneration. Therefore, according to the invention, an inhibitor with the expression for inhibiting antibiotic peptide Lebocin is applied to preparation of an insecticide for the first time.

Description

technical field [0001] The present invention relates to the application of the antimicrobial peptide Lebocin of lepidopteran insects in pest control, and specifically relates to the function of the unique antimicrobial peptide Lebocin of lepidopteran insects affecting the metamorphosis of insects, so as to carry out research and development of transgenes or inhibitors around lebocin to achieve the goal of pest control Purpose. Background technique [0002] The existence of antimicrobial peptides enables insects to have a very strong immune system, which can efficiently resist the invasion of external microorganisms. Antimicrobial peptides were first discovered in plants, and currently more than 800 antimicrobial peptides have been found in animals and plants. According to preliminary statistics, more than 200 insect antimicrobial peptides have been discovered so far, concentrated in Lepidoptera, Coleoptera, Diptera, Hymenoptera, and Hemiptera. There are 8 orders of insects...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01N55/00A01P7/04
Inventor 郑思春麦韬毅林献瑜
Owner SOUTH CHINA NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More