Unlock instant, AI-driven research and patent intelligence for your innovation.

Wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase (TaHMGR) gene, isolation and cloning method thereof, site-specific mutagenesis method thereof and enzyme function detection method thereof

A technology of methylglutaryl coenzyme and gene site-directed mutation, which is applied in the field of molecular biology and can solve the problems that have not been published or published.

Active Publication Date: 2015-12-02
CROP RES INST SHANDONG ACAD OF AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there has not been disclosed or published in the prior art about isolating and cloning the complete 3-hydroxy-3-methylglutaryl-CoA reductase gene, gene site-directed mutation, Gene prokaryotic expression, separation and purification of enzyme protein, and in vitro detection of enzyme function and other research data information, so it is necessary to conduct in-depth research on it and develop its related applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase (TaHMGR) gene, isolation and cloning method thereof, site-specific mutagenesis method thereof and enzyme function detection method thereof
  • Wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase (TaHMGR) gene, isolation and cloning method thereof, site-specific mutagenesis method thereof and enzyme function detection method thereof
  • Wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase (TaHMGR) gene, isolation and cloning method thereof, site-specific mutagenesis method thereof and enzyme function detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] Example 1 (Wheat variety "Jimai 22" leaf RNA extraction)

[0079] [1] Take about 100 mg of wheat leaves and quickly grind them into powder in liquid nitrogen, add 500 μl of RL (check whether β-mercaptoethanol has been added before use), and immediately vortex vigorously to mix.

[0080] [2] Transfer all the solution to the filter column CS (the filter column CS is placed in the collection tube), centrifuge at 13,000rpm (13,400×g) for 2-5min, carefully pipette the supernatant in the collection tube into the new RNase-Free In the centrifuge tube, the tip should try to avoid contact with the cell debris in the collection tube.

[0081] [3] Slowly add 0.5 times the supernatant volume of absolute ethanol (about 260ul), mix well (precipitation may appear at this time), transfer the obtained solution and precipitation into the adsorption column CR3, 13,000rpm (13,400× g) Centrifuge for 1 min, discard the waste liquid in the collection tube, and put the adsorption column CR3 b...

Embodiment 2

[0091] Example 2 (synthesis of the first strand of cDNA)

[0092] [1] Add the following reaction mixture to a nuclease-free centrifuge tube in an ice bath:

[0093] 50-500ng mRNA;

[0094] 2μloligo(dT)15

[0095] 2μl SuperPuredNTPs (2.5mMeach);

[0096] RNase-FreeddH 2 O was adjusted to 14.5 μl.

[0097] [2] After heating at 70°C for 5 minutes, quickly cool on ice for 2 minutes. After brief centrifugation to collect the reaction solution, the following components were added: 4 μl 5×First-StrandBuffer (containing DTT); 0.5 μl RNasin.

[0098] [3] Add 1 μl (200U) TIANScriptM-MLV, and mix gently with a pipette.

[0099] [4] Warm bath at 42°C for 50 minutes.

[0100] [5] Heat at 95°C for 5 minutes to terminate the reaction, and place on ice for subsequent experiments or cryopreservation.

[0101] [6] Dilute the reaction system to 50 μl with RNase-FreeddH2O, and take 2-5 μl for PCR amplification reaction.

Embodiment 3

[0102] Example 3 (intermediate sequence amplification, product recovery, connection and transformation, clone identification)

[0103] 1. PCR amplification and detection of the middle sequence of the gene

[0104] By searching and comparing the HMGR sequences of a variety of known plants, especially the plants closely related to wheat, the highly conserved region of the gene sequence was found, and Primer5.0 was used to design intermediate sequence amplification primers to amplify the corresponding sequence of wheat hmgr.

[0105] Upstream primer mhmgrF1: CGATGGCCGGGAGGAACCTGTACATGAG, its nucleotide sequence is shown in SeqIDNo.3,

[0106] The downstream primer mhmgrR1:CACCACCAACTGTGCCCACCTCAAT, its nucleotide sequence is shown in SeqIDNo.4.

[0107] The PCR system is 50ul, and the components are as follows:

[0108]

[0109] The PCR program was pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 sec, annealing at 63°C for 30 sec, extension at 72°C for 35 s, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology, and relates to an isolation and cloning, gene site-specific mutagenesis, zymoprotein prokaryotic expression, zymoprotein separation and purification, and enzymatic activity detection technology for a first key enzyme gene participating in isoprenoid substance synthesis in wheat mevalonic acid metabolic pathways. Important technical reserves are provided for further carrying out gene modification and augmentation, constructing eukaryotic genetic expression vectors of 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGR) genes and converting corresponding products, and are particularly provided for obtaining plants with the high commercial value through secondary metabolism, discussing the relationship between overexpression of the HMGR genes in the receiver plants and important economical characters such as secondary metabolism products, the crop grain size and the grain weight, then increasing the crop yield, analyzing the structures of introns, exons and promoters of the HMGR genes, researching the functions of the promoters and developing related molecular markers.

Description

technical field [0001] The invention belongs to the field of molecular biology and relates to wheat 3-hydroxy-3-methylglutaryl-CoA reductase, the first key enzyme gene involved in the synthesis of isoprenoid substances in the metabolic pathway of wheat mevalonate Gene TaHMGR and its isolation and clone, site-directed mutation and detection method of enzyme function. Background technique [0002] Isoprenoid substances are important substances necessary for maintaining plant growth and development, photosynthesis, electron transfer, and coping with environmental stress. Such substances can be used as photosynthetic pigments (such as chlorophyll, carotenoids), growth substances and plant hormones (such as cytokinins, abscisic acid, gibberellins and brassinosteroids), part of membrane structures such as sitosterol, electron transport Receptors such as plastoquinone, receptors for glucose in glucosylation reactions such as dolichol, and can regulate cell growth (such as prenyl p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/53C12N9/04
Inventor 楚秀生刘洋洋崔德周郭栋樊庆琦隋新霞黄承彦
Owner CROP RES INST SHANDONG ACAD OF AGRI SCI