Wheat 3-hydroxy-3-methylglutaryl-coenzyme A reductase (TaHMGR) gene, isolation and cloning method thereof, site-specific mutagenesis method thereof and enzyme function detection method thereof
A technology of methylglutaryl coenzyme and gene site-directed mutation, which is applied in the field of molecular biology and can solve the problems that have not been published or published.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0078] Example 1 (Wheat variety "Jimai 22" leaf RNA extraction)
[0079] [1] Take about 100 mg of wheat leaves and quickly grind them into powder in liquid nitrogen, add 500 μl of RL (check whether β-mercaptoethanol has been added before use), and immediately vortex vigorously to mix.
[0080] [2] Transfer all the solution to the filter column CS (the filter column CS is placed in the collection tube), centrifuge at 13,000rpm (13,400×g) for 2-5min, carefully pipette the supernatant in the collection tube into the new RNase-Free In the centrifuge tube, the tip should try to avoid contact with the cell debris in the collection tube.
[0081] [3] Slowly add 0.5 times the supernatant volume of absolute ethanol (about 260ul), mix well (precipitation may appear at this time), transfer the obtained solution and precipitation into the adsorption column CR3, 13,000rpm (13,400× g) Centrifuge for 1 min, discard the waste liquid in the collection tube, and put the adsorption column CR3 b...
Embodiment 2
[0091] Example 2 (synthesis of the first strand of cDNA)
[0092] [1] Add the following reaction mixture to a nuclease-free centrifuge tube in an ice bath:
[0093] 50-500ng mRNA;
[0094] 2μloligo(dT)15
[0095] 2μl SuperPuredNTPs (2.5mMeach);
[0096] RNase-FreeddH 2 O was adjusted to 14.5 μl.
[0097] [2] After heating at 70°C for 5 minutes, quickly cool on ice for 2 minutes. After brief centrifugation to collect the reaction solution, the following components were added: 4 μl 5×First-StrandBuffer (containing DTT); 0.5 μl RNasin.
[0098] [3] Add 1 μl (200U) TIANScriptM-MLV, and mix gently with a pipette.
[0099] [4] Warm bath at 42°C for 50 minutes.
[0100] [5] Heat at 95°C for 5 minutes to terminate the reaction, and place on ice for subsequent experiments or cryopreservation.
[0101] [6] Dilute the reaction system to 50 μl with RNase-FreeddH2O, and take 2-5 μl for PCR amplification reaction.
Embodiment 3
[0102] Example 3 (intermediate sequence amplification, product recovery, connection and transformation, clone identification)
[0103] 1. PCR amplification and detection of the middle sequence of the gene
[0104] By searching and comparing the HMGR sequences of a variety of known plants, especially the plants closely related to wheat, the highly conserved region of the gene sequence was found, and Primer5.0 was used to design intermediate sequence amplification primers to amplify the corresponding sequence of wheat hmgr.
[0105] Upstream primer mhmgrF1: CGATGGCCGGGAGGAACCTGTACATGAG, its nucleotide sequence is shown in SeqIDNo.3,
[0106] The downstream primer mhmgrR1:CACCACCAACTGTGCCCACCTCAAT, its nucleotide sequence is shown in SeqIDNo.4.
[0107] The PCR system is 50ul, and the components are as follows:
[0108]
[0109] The PCR program was pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 sec, annealing at 63°C for 30 sec, extension at 72°C for 35 s, a...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap