Preparation method and application of SEI monoclonal antibody
A monoclonal antibody, SEI technology, applied in the field of immunology, can solve the problems of low specificity, low antibody efficiency, low repeatability, etc., and achieve the effect of high purity, strong specificity, and small protein loss
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] 1. Preparation of SEI monoclonal antibody:
[0026] 1. Preparation and purification of SEI recombinant protein:
[0027] 1) Source of the strain: the preserved Staphylococcus aureus (containing the sei gene, the gene sequence has been submitted to the GenBank database, and the accession number of the gene is KT853046) was used.
[0028] 2) According to the sequence of the sei gene, primers for the novel enterotoxin sei gene of Staphylococcus aureus were designed:
[0029] Upstream primer: CGTACG GAATTC ATGAAAAAATTTAAATATAG(EcoR1);
[0030] Downstream primer: CGCTAG GTC GAC TTAGTTACTATTCATA (SalI).
[0031] 3) Plasmid construction: PCR amplification was performed using the DNA of Staphylococcus aureus as a template to obtain a complete fragment of the sei gene and connect it to pMD Vector (Takara Company), for sequencing.
[0032] 4) Construction of the expression plasmid: EcoR1 (Tiangen Company) and SalI (Tiangen Company) digested the PCR product and pET-28a(+)...
Embodiment 2
[0095] Application of SEI monoclonal antibody:
[0096] 1. Using the SEI monoclonal antibody prepared above, prepare a reagent strip or kit for detecting SEI in the sample.
[0097] 2. SEI monoclonal antibody is used to construct SEI double-antibody sandwich detection method:
[0098] Using the SEI monoclonal antibody prepared above, a double-antibody sandwich ELISA method for detecting SEI was established, and the specific steps were as follows:
[0099] Coat the microtiter plate with 2.2-3.5 μg / mL of SEI monoclonal antibody prepared above and wash the plate overnight at 4°C to wash away the coated antibody that is not bound to the microtiter plate; add blocking solution to the enzyme Block the excess binding sites on the target plate, wash the plate, and wash away the excess blocking solution on the microplate plate; add the detection sample on the microplate plate, wash the plate after incubation; add the enzyme label with SEI rabbit antiserum as the primary antibody Wash...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com