Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method and application of SEI monoclonal antibody

A monoclonal antibody, SEI technology, applied in the field of immunology, can solve the problems of low specificity, low antibody efficiency, low repeatability, etc., and achieve the effect of high purity, strong specificity, and small protein loss

Inactive Publication Date: 2016-01-06
SOUTHWEST UNIVERSITY FOR NATIONALITIES
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Traditional methods of immunizing animals have low efficiency and limited yield, and the serum polyclonal antibody produced is a mixture of various antibodies. This polyclonal antibody has low specificity and low reproducibility in reacting with antigens.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of SEI monoclonal antibody
  • Preparation method and application of SEI monoclonal antibody
  • Preparation method and application of SEI monoclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] 1. Preparation of SEI monoclonal antibody:

[0026] 1. Preparation and purification of SEI recombinant protein:

[0027] 1) Source of the strain: the preserved Staphylococcus aureus (containing the sei gene, the gene sequence has been submitted to the GenBank database, and the accession number of the gene is KT853046) was used.

[0028] 2) According to the sequence of the sei gene, primers for the novel enterotoxin sei gene of Staphylococcus aureus were designed:

[0029] Upstream primer: CGTACG GAATTC ATGAAAAAATTTAAATATAG(EcoR1);

[0030] Downstream primer: CGCTAG GTC GAC TTAGTTACTATTCATA (SalI).

[0031] 3) Plasmid construction: PCR amplification was performed using the DNA of Staphylococcus aureus as a template to obtain a complete fragment of the sei gene and connect it to pMD Vector (Takara Company), for sequencing.

[0032] 4) Construction of the expression plasmid: EcoR1 (Tiangen Company) and SalI (Tiangen Company) digested the PCR product and pET-28a(+)...

Embodiment 2

[0095] Application of SEI monoclonal antibody:

[0096] 1. Using the SEI monoclonal antibody prepared above, prepare a reagent strip or kit for detecting SEI in the sample.

[0097] 2. SEI monoclonal antibody is used to construct SEI double-antibody sandwich detection method:

[0098] Using the SEI monoclonal antibody prepared above, a double-antibody sandwich ELISA method for detecting SEI was established, and the specific steps were as follows:

[0099] Coat the microtiter plate with 2.2-3.5 μg / mL of SEI monoclonal antibody prepared above and wash the plate overnight at 4°C to wash away the coated antibody that is not bound to the microtiter plate; add blocking solution to the enzyme Block the excess binding sites on the target plate, wash the plate, and wash away the excess blocking solution on the microplate plate; add the detection sample on the microplate plate, wash the plate after incubation; add the enzyme label with SEI rabbit antiserum as the primary antibody Wash...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a preparation method and an application of an SEI monoclonal antibody. The method comprises steps as follows: recombinant SEI immunizes BALB / c mice, splenocytes of the mice are directly fused with myeloma cells, an advantageous hybridoma cell strain producing the SEI monoclonal antibody is screened with the indirect ELISA (enzyme linked immunosorbent assay), and the SEI monoclonal antibody is obtained. The SEI monoclonal antibody prepared with the method is high in titer, stable in property and high in specificity, can be applied to reagent strips or kits, can quickly detect the content of SEI in samples, can be used for establishing an immunological detection method for the SEI and has bright application prospect.

Description

technical field [0001] The invention relates to the technical field of immunology, in particular to a preparation method and application of an SEI monoclonal antibody. Background technique [0002] Staphylococcal enterotoxins (SEs for short), produced by Staphylococcus aureus, are important pathogenic factors that can cause food poisoning, vomiting, diarrhea, and shock in humans. There are currently 23 serotypes of enterotoxins that have been discovered, among which SEI is a new type of enterotoxin with a theoretical molecular weight of 24.928KD, composed of 729 nucleotides, and expresses a mature protein with 242 amino acid residues. According to the survey, in the genotype detection of pathogenic Staphylococcus aureus, the detection rate of sei gene is as high as 89.5%. Based on the prevalence of the sei gene, the new enterotoxin SEI has the potential to threaten human health. Therefore, the establishment of SEI immunological detection method using SEI monoclonal antibod...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/12G01N33/68G01N33/577
Inventor 唐俊妮赵燕英朱安妮汤承陈娟王琼
Owner SOUTHWEST UNIVERSITY FOR NATIONALITIES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com