Negative selection marker for escherichia coli gene knock-in

An Escherichia coli, gene knock-in technology, applied in the field of genetic engineering, can solve problems such as increasing workload

Inactive Publication Date: 2016-01-13
NANJING NORMAL UNIVERSITY
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Some other negative selection markers, such as thyA, galK, rpsL, upp, and pryF, etc., need to mutate the host bacteria first to obtain mutant strains, and then use this mutant strain to carry out gene knock-in, which increases the workload on the one hand, and Limited by genetic manipulation and often requires the addition of certain growth elements to maintain the viability of the mutant strain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Negative selection marker for escherichia coli gene knock-in
  • Negative selection marker for escherichia coli gene knock-in
  • Negative selection marker for escherichia coli gene knock-in

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1. Construction of the plac-ccdB-aacC1 gene cassette

[0040] The plac-ccdB fragment was first PCR amplified. Design primer R2101: 5'-GTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGCAGTTTAAGGTTTACACC-3', (SEQ ID NO.1), R2102: 5'-GGA CTCGAG TTATATTCCCCCAGAACATCAGG-3', (SEQ ID NO. 2), R2103: 5'-G GAATTC TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGC-4', (SEQ ID NO. 3), restriction sites XhoI and HindIII are underlined. Using pMK2010 as a template, PR2101 and R2102 PCR amplified the 3' end of plac and ccdB gene of 363 bp, purified the 363 bp, and used it as a template, PCR amplified R2103 and R2102 to obtain a complete 414 bp of plac and ccdB gene. Secondly, aacC1 (gentamycin resistance gene) fragment was amplified by PCR. Design primer R2104: 5'-GGA CTCGAG TCGAATTGACATAAGCCTGTTC, (SEQ ID NO. 4), R2105: 5'-C AAGCTT TTAGGTGGCGGTACTTGGGTC, (SEQ ID NO.5), restriction sites XhoI and EcoRI are underlined. Using pBAD322G as a templa...

Embodiment 2

[0042] Example 2. Knock-in of the I-SceI gene to the uidA site of Escherichia coli MG1655

[0043] Escherichia coli MG1655 is a model Escherichia coli strain, and it is also a commonly used gene manipulation strain, so it has good applicability to carry out the negative screening function test of the present invention. The I-SceI gene is a homing nuclease, and its recognition site is 18 base pairs TAGGGATAA↓CAGGGTAAT- (representing the enzyme cutting site). Knocking it into the genome is beneficial to the gene shearing experiment of the resulting strain.

[0044] Design primers R2111: 5'-CCTTCCCGGCTTCGGAGAATTCCCCCCAAAATATTCACTGTAGCCATATGCTCACTCATTAGGCACCCCAG, (SEQ ID NO. 8), R2112: 5'-GTCCAGCGTTTTTGCAGCAGAAAAGCCGCCGACTTCGGTTTGCGGTCGCGTTAGGTGGCGGTACTTGGGTC, (SEQ ID NO. 9). Using pLS3161 as a template, R2111 and R2112 were amplified to obtain a 1265bp linear DNA fragment, which was recovered by ethanol precipitation and washed with ddH 2 O dissolved. Escherichia coli MG1655 co...

Embodiment 3

[0046] Example 3. Knock-in of the pir gene into the lacZ site of Escherichia coli MG1655

[0047] Because the genotype of Escherichia coli DB3.1λpir is not clear, and the transformation efficiency is low, the second embodiment of this method is about to knock the pir gene into the genome of Escherichia coli MG1655, and the gained bacterial strain helps to contain the R6K replicon plasmid. clone.

[0048] Design primers R2117: 5'-GCGTGGGCGTATTCGCAAAGGATCAGCGGGCGCGTCTCTCCAGGTAGCGACTCACTCATTAGGCACCCCAG, (SEQ ID NO. 14), R2118: 5'-GCTGCTGCTGAACGGCAAGCCGTTGCTGATTCGAGGCGTTAACCGTCACGTTAGGTGGCGGTACTTGGGTC, (SEQ ID NO. 15). Using pLS3161 as a template, R2117 and R2118 were amplified to obtain a 1265bp linear DNA fragment, which was recovered by ethanol precipitation and washed with ddH 2 O dissolved. Electroporation competent cells of the MG1655 strain expressing the recombinase were prepared as above, 1 μg of DNA fragments were electroporated, and 1020 clones were obtained under the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a negative selection marker for escherichia coli gene knock-in, namely, the virulent gene ccdB driven by a plac promoter, and plac-ccdB and the gentamicin resistance gene aacC1 form a gene cassette for gene knock-in. In the first step, DNA fragments containing homologous arms plac-ccdB and aacC1 are obtained through amplification, and electro-transformed into escherichia coli for expression of recombinase. Under gentamicin screening, recombinase catalyzes homologous recombination and the DNA fragments are integrated into escherichia coli genome. In the second step, same homologous arms are utilized for amplification of foreign DNA fragments, ccdB is expressed in the bacterial strains obtained in the first step during the electrotransformation for expression of recombinase under the screening of isopropyl-beta-d-isopropylthiogalactoside, the toxicity serves as the feature of the negative selection marker, recombinase catalyzes homologous recombination among homologous arms, and foreign DNA fragments replace a plac-ccdB-aacC1 gene cassette to realize gene knock-in.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a negative selection marker for knocking a target gene into the Escherichia coli genome by a recombination engineering method. Background technique [0002] Gene expression is an important means of modern biology and a necessary means to obtain therapeutic drug proteins and enzymes for catalysis. In the field of basic research, gene expression is also an essential strategy for studying the function of genes and proteins and studying the metabolism and regulation of organisms. Conventional gene expression usually involves cloning the target gene on a plasmid and then transforming it into a host bacterium (the most common is Escherichia coli). The plasmid replicates in the form of free chromosomes, and is usually expressed under induction. While plasmid-based expression is most common, chromosomal-based gene expression presents some unique advantages, such as the absence of anti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90C12N15/65C12N15/70C12N15/66C12R1/19
Inventor尚广东张青
OwnerNANJING NORMAL UNIVERSITY