Unlock instant, AI-driven research and patent intelligence for your innovation.

RNAi vector widely used for multi-plant gene silencing and application

A gene silencing and vector technology, applied in the biological field, can solve the problems of inability to use plant genetic transformation, and the report of pC1300-pHANNIBAL plant gene silencing vector has not yet been found, and achieve the effect of stable inheritance.

Inactive Publication Date: 2016-01-27
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the existing commercial RNAi vectors are used in animal host cells, and a few RNAi vectors that can be used in plants, such as pHANNIBAL, are non-binary expression vectors and cannot be used in Agrobacterium-mediated plant genetic transformation
[0004] After searching the prior art literature, it is found that there is no report on the pC1300-pHANNIBAL plant gene silencing vector and its construction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RNAi vector widely used for multi-plant gene silencing and application
  • RNAi vector widely used for multi-plant gene silencing and application
  • RNAi vector widely used for multi-plant gene silencing and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Cloning of CMV promoter and OCS terminator

[0042] 1. pHANNIBAL plasmid extraction

[0043]Pick Trans1-T1 Escherichia coli (purchased from TransGenBiotech) containing the pHANNIBAL carrier, and first dissolve in 750 μl LB medium (weighing 5 g of yeast extract, 10 g of tryptone, and 10 g of NaCl) in 1 L of water, adjust the pH to 7.0, and sterilize at 121 ° C Afterwards, cool to 50°C, add ampicillin antibiotic with a final concentration of 100mg / L) and cultivate overnight; inoculate 20 μl of bacterial solution in 20ml LB medium, and cultivate overnight; use a 1.5ml EP tube to centrifuge at 12000rpm for 1min to collect bacterial cells (per 5ml bacterial solution collected as a tube).

[0044] Add 100 μl solution I (glucose 50mmol / L, Tris-Cl25mmol / L, EDTA10mmol / L, pH=8.0) to the bacteria, resuspend the precipitate; then add 200μl solution II (H 2 (08ml, 10% SDS1ml, 2MNaOH1ml), gently flip the EP tube, 5 to 6 times until the solution becomes clear; add 150 μl ...

Embodiment 2

[0054] Example 2: Construction of pC1300-pHANNIBAL vector

[0055] 1. Construction of 1300-CMV vector

[0056] The two plasmids were double digested with EcoRI and SacI, respectively. The enzyme digestion system is as follows:

[0057]

[0058]

[0059] After preparing the above mixture, gently pipette to mix, incubate in a 37°C incubator for 3.5 hours, then electrophoresis, gel recovery, and connection.

[0060] According to the brightness of the target band after electrophoresis, add the corresponding volume of gel recovery solution according to the molar ratio of the fragment to the carrier of 3:1 to 7:1, and use T4 ligase to connect CMV into the pCAMBIA1300 vector. The connection system is as follows:

[0061]

[0062] After the above mixture is prepared, gently pipette and mix well, and connect overnight at 16°C (about 8-9 hours). The ligation product was transformed into Trans1-T1 Escherichia coli, a single clone was picked, and after correct sequencing, the...

Embodiment 3

[0069] Example 3: Construction and application of TAR1 gene RNAi vector in Artemisia annua

[0070] 1. TAR1-RNAi vector construction

[0071] Obtain the TAR1 sequence (EZ159016) from NCBI, and design a forward primer TAR1-RNAiF with a restriction site near the 3' end: aaa TCTAG AaaaCCATGGcctcttaacaagccagagtc (SEQIDNO: 9) (containing NcoIandXbaI restriction site) and reverse primer TAR1-RNAiR: aaa GGATCC aaa GGTACC ccttggatgagatacactgtc (SEQ ID NO: 10) (containing BamHIandKpnI restriction site), using EasyPfuDNAPolymerase enzyme for PCR amplification. The PCR system and conditions refer to Example 2, and the extension time is 30 sec.

[0072] First use NcoI and KpnI to double digest the TAR1 gene fragment plasmid obtained in the previous step in this example and the pC1300-pHANNIBAL vector plasmid obtained in Example 2, recover from the gel, connect with T4 ligase, and connect the TAR1 gene fragment forward into pC1300 -pHANNIBAL to obtain the 35S:TAR1F::PDK::OCS vector;...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a RNAi vector widely used for multi-plant gene silencing and application, and belongs to the field of biotechnology. The vector is constructed by use of pCAMBIA1300 carrier as a skeleton and insertion of Promoter (CMV), PDK and Terminator 1 (OCS) sequence into pHANNIBAL carrier, the vector construction comprises the following steps: first, through PCR amplification and restriction endonuclease enzyme digestion connection technology, CMV and OCS containing enzyme digestion sites are sequentially connected with the pCAMBIA1300 carrier; and second, PDK is inserted between the CMV and OCS for eventually forming pC1300-pHANNIBAL carrier. The vector is a binary expression vector which can be integrated into a plant genome, and can be stably inherited and expressed in a plant host cell, and the vector is a convenient, reliable, economical and practical means of gene silencing.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the construction and application of an RNAi vector widely used for gene silencing in various plants. Background technique [0002] Gene silencing is an important way to study the regulation of gene expression and reveal the nature of molecular genetic expression. RNA interference (RNAi) is a commonly used gene silencing method, through the artificial design of interfering RNA homologous to specific gene mRNA to achieve specific gene expression down-regulation. [0003] RNAi vectors are necessary for successful specific gene silencing, enabling gene elimination, gene function studies, or transgenic crop cultivation. The existing commercial RNAi vectors are mostly used in animal host cells, and a few RNAi vectors that can be used in plants, such as pHANNIBAL, are non-binary expression vectors and cannot be used in Agrobacterium-mediated plant genetic transformation. [0004] After se...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/66C12N1/21A01H5/00
Inventor 谭何新张磊肖玲邸鹏肖莹
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More