Recombinant Escherichia coli with efficiently expressed [2Fe2S] ferredoxin and application of recombinant Escherichia coli

A recombinant Escherichia coli and high-efficiency expression technology, which is applied to recombinant Escherichia coli expressing [2Fe2S]ferredoxin efficiently and its application field, can solve the problems of high protein price, low expression amount and low activity, and achieves good application prospects , high expression, cost-saving effect

Inactive Publication Date: 2016-02-24
INST OF BASIC MEDICINE OF SAMS
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, only the [2Fe2S] type ferredoxin from spinach is commercially sold. However, due to species differences, this ferredoxin shows different efficiencies when analyzing enzymes from other species, and the protein is very expensive , which largely limits the application of ferredoxin and scientists' research on ferredoxin-related enzymes and metabolic processes
[0003] In the existing literature reports, most ferredoxins are purified from wild bacteria and other organisms, and are also prepared by heterologous expression, but these methods have many shortcomings, such as consuming a lot of time and cumbersome purification steps , low expression, incomplete iron-sulfur cluster assembly of ferredoxin and low activity, low final yield and purity, etc.
Based on this, the research and development of methods capable of efficiently expressing [2Fe2S] ferredoxin has become an urgent problem to be solved. After searching, there are related recombinant Escherichia coli that can efficiently express [2Fe2S] ferredoxin and its production of [2Fe2S ] The application of ferredoxin has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant Escherichia coli with efficiently expressed [2Fe2S] ferredoxin and application of recombinant Escherichia coli
  • Recombinant Escherichia coli with efficiently expressed [2Fe2S] ferredoxin and application of recombinant Escherichia coli
  • Recombinant Escherichia coli with efficiently expressed [2Fe2S] ferredoxin and application of recombinant Escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Construction of recombinant Escherichia coli expressing the [2Fe2S] ferredoxin in C. pasteurianum DSM525

[0035] Take C.pasteurianumDSM525 cells and extract genomic DNA from C.pasteurianumDSM525 cells according to the recommended method of bacterial genomic DNA extraction kit. According to the known [2Fe2S] ferredoxin gene sequence in the DSM525 genome of C. pasteurianum (C. pasteurianum) as shown in SEQ ID NO. 1, the primers are designed as follows:

[0036] F primer: 5'CGCGGATCCGATGGTAAACCCAAAACAC3'

[0037] R primer: 5'CCCAAGCTTAATTTGAAGTCTTTTAAC3'

[0038] Using the extracted C. pasteurianum DSM525 genomic DNA as a template, PCR amplification was performed to obtain the [2Fe2S] type ferredoxin gene. The PCR reaction system is as follows:

[0039]

[0040]

[0041] The PCR reaction conditions are:

[0042] 95℃5min

[0043] 95℃30s, 55℃30s, 72℃30s 30 cycles

[0044] 72℃10min

[0045] 4℃ heat preservation

[0046] After the PCR product was initially confirmed to be corre...

Embodiment 2

[0052] Example 2: Application of recombinant E. coli for efficient expression of [2Fe2S] ferredoxin

[0053] (1) The recombinant E. coli strain constructed in Example 1 was inoculated into a TB medium containing antibiotics and an iron-sulfur source at an inoculum of 1% by volume, and cultured at 37°C and 180rpm for 2 to 3 hours to OD 620nm Is 0.6 to obtain bacterial liquid;

[0054] Among them, the formula and final concentration of the components of the TB medium are: Tryptone 12g / L, Yeastextract 24g / L, Glycerol 4ml / L, KH 2 PO 4 2.3g / L, K 2 HPO 4 12.5g / L;

[0055] The above antibiotics are chloramphenicol with a final concentration of 25μg / ml, tetracycline with a final concentration of 10μg / ml, and ampicillin with a final concentration of 100μg / ml;

[0056] The above iron-sulfur source formula and final concentration of the components are: ferric ammonium citrate 0.2-0.3g / L, L-cysteine ​​0.1-0.2g / L, ferric citrate 0.18-0.3g / L, FeSO 4 ·7H 2 O0.25-0.4g / L;

[0057] (2) Add IPTG with a fi...

Embodiment 3

[0060] Example 3: Separation, purification and activity determination of [2Fe2S]ferredoxin.

[0061] The protein purification is carried out in an anaerobic operation box, and all the solutions used are degassed and anaerobic treated after boiling.

[0062] Prepare the buffer needed for purification: buffer A: sodium phosphate 20mM, NaCl0.5M, pH7.4; buffer B: sodium phosphate 20mM, NaCl0.5M, imidazole 500mM, pH7.4; the formula of buffer W is: Sodium phosphate 50mM, pH7.4; Buffer W: Sodium phosphate 50mM, pH7.0.

[0063] Obtaining crude enzyme solution: the frozen cells prepared in Example 2 were resuspended in buffer A containing 10% glycerol, and the cells were disrupted using an ultrasonic disruptor. The cell disruption procedure was: working time 6 seconds, intermittent time 6 seconds , The power is 39%, and the total crushing time is 50 minutes. Centrifuge at 12,000 rpm for 30 min after the crushing is completed, and then take the supernatant and filter it with a 0.22um pore fi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant Escherichia coli with efficiently expressed [2Fe2S] ferredoxin. The recombinant Escherichia coli is named as Escherichia coli pCodonPlus / pRKISC / pETDuet-[2Fe2S]Fd and contains [2Fe2S] ferredoxin genes. Nucleotide sequences of the recombinant Escherichia coli are shown as SEQ ID NO.1. The [2Fe2S] ferredoxin genes are connected into pETDuet-1 carriers to obtain recombinant plasmids of the recombinant Escherichia coli, and the obtained recombinant plasmids are named as pETDuet-[2Fe2S] and are transferred into E.coli C41(DE3) with pCodonPlus and pRKISC plasmids to obtain the recombinant Escherichia coli. The invention further discloses application of the recombinant Escherichia coli to fermenting and producing the [2Fe2S] ferredoxin. The recombinant Escherichia coli and the application have the advantages that as proved by experiments, 40 mg of purified [2Fe2S] ferredoxin can be ultimately obtained from each liter of fermentation culture, the yield of the purified [2Fe2S] ferredoxin is far higher than previously reported 2mg yield of [2Fe2S] ferredoxin expressed in existing recombinant Escherichia coli and 0.2mg yield of [2Fe2S] ferredoxin purified from wild fungi, and the recombinant Escherichia coli is predicted to have an excellent application prospect in industrial production.

Description

Technical field [0001] The invention relates to genetic recombination engineering bacteria and applications thereof, in particular to a recombinant Escherichia coli expressing [2Fe2S] ferredoxin and applications thereof. Background technique [0002] Ferredoxin is a type of acidic protein containing iron-sulfur clusters. The iron-sulfur clusters are mainly divided into [4Fe4S], [2Fe2S], [3Fe4S] and other types. As a common electron carrier, ferredoxin participates in important metabolic processes such as respiration, photosynthesis, and fermentation. Currently, only [2Fe2S] ferredoxin from spinach is commercially available. However, due to species differences, this ferredoxin shows different efficiency when analyzing enzymes from other species, and the protein is very expensive This largely limits the application of ferredoxin and scientists’ research on ferredoxin-related enzymes and metabolic processes. [0003] In the existing literature reports, most ferredoxins are purified ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P21/02C12N15/70C12R1/19
CPCC07K14/245C12P21/02
Inventor黄海燕王书宁胡烈杰许晓群王郡甫栾俊文苏庆红
OwnerINST OF BASIC MEDICINE OF SAMS