Recombinant Escherichia coli with efficiently expressed [2Fe2S] ferredoxin and application of recombinant Escherichia coli
A recombinant Escherichia coli and high-efficiency expression technology, which is applied to recombinant Escherichia coli expressing [2Fe2S]ferredoxin efficiently and its application field, can solve the problems of high protein price, low expression amount and low activity, and achieves good application prospects , high expression, cost-saving effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Construction of recombinant Escherichia coli expressing the [2Fe2S] ferredoxin in C. pasteurianum DSM525
[0035] Take C.pasteurianumDSM525 cells and extract genomic DNA from C.pasteurianumDSM525 cells according to the recommended method of bacterial genomic DNA extraction kit. According to the known [2Fe2S] ferredoxin gene sequence in the DSM525 genome of C. pasteurianum (C. pasteurianum) as shown in SEQ ID NO. 1, the primers are designed as follows:
[0036] F primer: 5'CGCGGATCCGATGGTAAACCCAAAACAC3'
[0037] R primer: 5'CCCAAGCTTAATTTGAAGTCTTTTAAC3'
[0038] Using the extracted C. pasteurianum DSM525 genomic DNA as a template, PCR amplification was performed to obtain the [2Fe2S] type ferredoxin gene. The PCR reaction system is as follows:
[0039]
[0040]
[0041] The PCR reaction conditions are:
[0042] 95℃5min
[0043] 95℃30s, 55℃30s, 72℃30s 30 cycles
[0044] 72℃10min
[0045] 4℃ heat preservation
[0046] After the PCR product was initially confirmed to be corre...
Embodiment 2
[0052] Example 2: Application of recombinant E. coli for efficient expression of [2Fe2S] ferredoxin
[0053] (1) The recombinant E. coli strain constructed in Example 1 was inoculated into a TB medium containing antibiotics and an iron-sulfur source at an inoculum of 1% by volume, and cultured at 37°C and 180rpm for 2 to 3 hours to OD 620nm Is 0.6 to obtain bacterial liquid;
[0054] Among them, the formula and final concentration of the components of the TB medium are: Tryptone 12g / L, Yeastextract 24g / L, Glycerol 4ml / L, KH 2 PO 4 2.3g / L, K 2 HPO 4 12.5g / L;
[0055] The above antibiotics are chloramphenicol with a final concentration of 25μg / ml, tetracycline with a final concentration of 10μg / ml, and ampicillin with a final concentration of 100μg / ml;
[0056] The above iron-sulfur source formula and final concentration of the components are: ferric ammonium citrate 0.2-0.3g / L, L-cysteine 0.1-0.2g / L, ferric citrate 0.18-0.3g / L, FeSO 4 ·7H 2 O0.25-0.4g / L;
[0057] (2) Add IPTG with a fi...
Embodiment 3
[0060] Example 3: Separation, purification and activity determination of [2Fe2S]ferredoxin.
[0061] The protein purification is carried out in an anaerobic operation box, and all the solutions used are degassed and anaerobic treated after boiling.
[0062] Prepare the buffer needed for purification: buffer A: sodium phosphate 20mM, NaCl0.5M, pH7.4; buffer B: sodium phosphate 20mM, NaCl0.5M, imidazole 500mM, pH7.4; the formula of buffer W is: Sodium phosphate 50mM, pH7.4; Buffer W: Sodium phosphate 50mM, pH7.0.
[0063] Obtaining crude enzyme solution: the frozen cells prepared in Example 2 were resuspended in buffer A containing 10% glycerol, and the cells were disrupted using an ultrasonic disruptor. The cell disruption procedure was: working time 6 seconds, intermittent time 6 seconds , The power is 39%, and the total crushing time is 50 minutes. Centrifuge at 12,000 rpm for 30 min after the crushing is completed, and then take the supernatant and filter it with a 0.22um pore fi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
