Identification method for conventional rice varieties Huai rice No.5 and No.18 based on InDel marks
An identification method, the technology of conventional rice, applied in the field of biological identification, can solve the problems of high error rate, variety confusion, long time period, etc., and achieve the effects of less sample consumption, good application and promotion prospects, and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Embodiment 1: the extraction of rice DNA
[0029] Utilize the primer pair used in the invention and perform genome polymorphism analysis based on PCR amplification;
[0030] The amplification system used is: 20 μL, including 30-50 ng of template DNA, 0.25 units of DNA polymerase (Shenergy), 2.0 μL of 10× Buffer (containing Mg2+), 2.0 mMdNTPs 2 μL;
[0031] The amplification program used is: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30s, renaturation at 58°C for 30s, extension at 72°C for 30s, 32 cycles; final extension at 72°C for 7 minutes;
[0032] Electrophoresis detection: add an appropriate amount of loading buffer to the amplified product, and after 100 minutes of electrophoresis on a 12% denatured polyacrylamide gel under a constant electric field strength of 22V / cM, the color will be developed by silver staining; When the sample is combined with the aforementioned 24 pairs of primers, it can be amplified at different sites (primer pairs) ...
Embodiment 2
[0034] Example 2: Genotype Identification of Rice Varieties Huaidao 5 and Huaidao 18
[0035] Use the following primers of the present invention for the identification of rice varieties Huaidao 5 and Huaidao 18;
[0036] serial number Primer pair name Forward primer sequence (5'->3') Reverse primer sequence (5'->3') 1-1 chr01-1 gttgttcagtcaaaagtttcagc tccttatgtgaagtggaagtataac 1-2 chr01-2 atcggtagcactaaatctttcc gatagggttttaggtttttcgag 2-1 chr02-1 gtaagactagctgtttcaatcacag gtatgaggtatagacatgggagaac 2-2 chr02-2 agttgagatgaatagctagatggag aacttgaggaggatcggtatc 3-1 chr03-1 ggatcaagtagcacgataagc acctattggttgtgtgtcttgtag 3-2 chr03-2 tgtctcattcagagtatggagttc ttagattggagctatagttgaggac 4-1 chr04-1 cattgacttttcaacacattgg cataaatttccaggccatatactac 4-2 chr04-2 aacaaccgaaaggtatatgacac gaatccttaaaattgtaccgtagtg 5-1 chr05-1 gaactcttgctcttcatagaaaatg taatactcatcctctccgatcc 5-2 chr05-2 c...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 